| Allele Name | tm3949 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | Y87G2A.3 |
| Gene Name | atg-4.1 |
| Worm Base | Allele Name |
tm3949
|
| Gene Name |
atg-4.1
|
| Sequence |
Y87G2A.3
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable. |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 47069/47070-47385/47386 (326 bp deletion) |
| Chromosome | I |
| Putative gene structure | complement(join(46352..46470, 47187..47813, 48082..48173, 49521..49749, 50412..50553, 50606..50661, 51264..51335, 51387..51531)) |
| Map position | 21.38 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | IntFwd:ATCAACTTCCATATCGGGAC,ExtFwd:CGGCGCCGATGTCATCGAAT,IntRev:TCCCTCTCCCCAGGCAATAT,ExtRev:CCTCGTCGACAAAAACCGTC |
| Distributed lab | |
| Depositor | Dr. S. Mitani |
| References |
Please submit your publication
Chen HD, Kao CY, Liu BY, Huang SW, Kuo CJ, Ruan JW, Lin YH, Huang CR, Chen YH, Wang HD, Aroian RV, Chen CS. HLH-30/TFEB-mediated autophagy functions in a cell-autonomous manner for epithelium intrinsic cellular defense against bacterial pore-forming toxin in C. elegans. Autophagy 2017 13(2) 371-385
[ PubMed ID = 27875098 ]
[ RRC reference ]
|
Palmisano NJ, Meléndez A. Detection of Autophagy in Caenorhabditis elegans. Cold Spring Harb Protoc 2016 2016(2) pdb.top070466
[ PubMed ID = 26832690 ]
[ RRC reference ]
|
|