| Allele Name | tm3941 |
| Balance | Completed |
| OutCross | Not Accepted |
| Sequence Name | Y105E8A.3 |
| Gene Name | Y105E8A.3 |
| Worm Base | Allele Name |
tm3941
(x1) |
| Gene Name |
Y105E8A.3
|
| Sequence |
Y105E8A.3
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| lethal or sterile. |
|
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 25140/25141-25773/25774 (633 bp deletion) |
| Chromosome | I |
| Putative gene structure | join(25501..25562, 25607..25729, 25795..26120, 26746..26939, 27768..28086, 29660..30045, 31473..31976, 33263..33496, 34152..34244) |
| Map position | 24.5 |
| Balancer | hIn1[nIs425] |
| Map position of balancer | |
| Sequence of primers | IntFwd:GGATAGCTTTTGTCGGCCGA,ExtFwd:GGATAGCTCAGTGTTCCCTG,IntRev:GGATCCTCAATAGTTCCGTC,ExtRev:CAAGCGCCAAATCCTTACGA |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Murari E, Meadows D, Cuda N, Mangone M.
A comprehensive analysis of 3'UTRs in Caenorhabditis elegans.
Nucleic Acids Res 2024 52(13) 7523-7538
[ PubMed ID = 38917330 ]
[ RRC reference ]
|
Weng Y, Murphy CT.
Male-specific behavioral and transcriptomic changes in aging C. elegans neurons.
iScience 2024 27(6) 109910
[ PubMed ID = 38783998 ]
[ RRC reference ]
|
Mazzetto M, Gonzalez LE, Sanchez N, Reinke V.
Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis.
Genome Res 2024 34(1) 57-69
[ PubMed ID = 38164610 ]
[ RRC reference ]
|
Dejima K, Imae R, Suehiro Y, Yoshida K, Mitani S.
An endomembrane zinc transporter negatively regulates systemic RNAi in Caenorhabditis elegans.
iScience 2023 26(6) 106930
[ PubMed ID = 37305693 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.