分離済み変異体

tm3886

Allele Nametm3886
BalanceNot Required
OutCrossNot Accepted
Sequence NameY76B12C.2
Gene Namexpc-1
Worm BaseAllele Name tm3886
Gene Name xpc-1
Sequence Y76B12C.2
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 24156/24157-GCTGGGGCTGGGTCGCTAGAAAAA-24630/24631 (474 bp deletion + 24 bp insertion)
ChromosomeIV
Putative gene structurejoin(23205..23327, 23762..24752, 26575..27035, 29494..29817, 31016..31424, 32544..32763, 34005..34302, 35754..35929, 36655..36748, 37743..38006)
Map position-12.3
Balancer
Map position of balancer
Sequence of primersExtFwd:ATCTCCCGCCGACCGCATAT,ExtRev:CTTCCACGGCTGATCGGGTT,IntFwd:GCCGCCCAGCTCTCCATATT,IntRev:CCGCGTTTTTGCTGCCTGGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Totska K, Barata JCVV, Sandt W, Meyer DH, Schumacher B.
Age Deceleration and Reversal Gene Patterns in Dauer Diapause.
Aging Cell 2025 24(12) e70253 
[ PubMed ID = 41104926 ] [ RRC reference ]

Robu M, Shah RG, van den Heuvel D, Coulombe Y, Bazin M, van der Woude M, Kragten A, Lans H, Pascal JM, Masson JY, Luijsterburg MS, Shah GM.
PARP1 and PARylation facilitate transcription-coupled DNA repair by stabilizing the CSB-RNAPII complex.
Nucleic Acids Res 2025 53(22)  
[ PubMed ID = 41385329 ] [ RRC reference ]

Yan J, Bhanshali F, Shuzenji C, Mendenhall TT, Taylor SKB, Ermakova G, Cheng X, Bai P, Diwan G, Seraj D, Meyer JN, Sorensen PH, Hartman JH, Taubert S.
Eukaryotic Elongation Factor 2 Kinase EFK-1/eEF2K promotes starvation resistance by preventing oxidative damage in C. elegans.
Nat Commun 2025 16(1) 1752 
[ PubMed ID = 39966347 ] [ RRC reference ]

Rieckher M, Gallrein C, Alquezar-Artieda N, Bourached-Silva N, Vaddavalli PL, Mares D, Backhaus M, Blindauer T, Greger K, Wiesner E, Pontel LB, Schumacher B.
Distinct DNA repair mechanisms prevent formaldehyde toxicity during development, reproduction and aging.
Nucleic Acids Res 2024 52(14) 8271-8285 
[ PubMed ID = 38894680 ] [ RRC reference ]

Nakayama A, Watanabe M, Yamashiro R, Kuroyanagi H, Matsuyama HJ, Oshima A, Mori I, Nakano S.
A hyperpolarizing neuron recruits undocked innexin hemichannels to transmit neural information in Caenorhabditis elegans.
Proc Natl Acad Sci U S A 2024 121(21) e2406565121 
[ PubMed ID = 38753507 ] [ RRC reference ]

Muniesa-Vargas A, Davó-Martínez C, Ribeiro-Silva C, van der Woude M, Thijssen KL, Haspels B, Häckes D, Kaynak ÜU, Kanaar R, Marteijn JA, Theil AF, Kuijten MMP, Vermeulen W, Lans H.
Persistent TFIIH binding to non-excised DNA damage causes cell and developmental failure.
Nat Commun 2024 15(1) 3490 
[ PubMed ID = 38664429 ] [ RRC reference ]

Kose C, Lindsey-Boltz LA, Sancar A, Jiang Y.
Genome-wide analysis of transcription-coupled repair reveals novel transcription events in Caenorhabditis elegans.
bioRxiv 2024   
[ PubMed ID = 37904932 ] [ RRC reference ]

Mazzetto M, Gonzalez LE, Sanchez N, Reinke V.
Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis.
Genome Res 2024 34(1) 57-69 
[ PubMed ID = 38164610 ] [ RRC reference ]

van der Woude M, Davó-Martínez C, Thijssen KL, Vermeulen W, Lans H.
Recovery of protein synthesis to assay DNA repair activity in transcribed genes in living cells and tissues.
Nucleic Acids Res 2023 51(18) e93 
[ PubMed ID = 37522336 ] [ RRC reference ]

Bujarrabal-Dueso A, Sendtner G, Meyer DH, Chatzinikolaou G, Stratigi K, Garinis GA, Schumacher B.
The DREAM complex functions as conserved master regulator of somatic DNA-repair capacities.
Nat Struct Mol Biol 2023 30(4) 475-488 
[ PubMed ID = 36959262 ] [ RRC reference ]

Furuta T, Arur S.
sart-3 functions to regulate germline sex determination in C. elegans .
MicroPubl Biol 2023 2023  
[ PubMed ID = 37206989 ] [ RRC reference ]

Dai Z, Zhang W, Shang M, Tang H, Wu L, Wu Y, Wang T, Bian P.
A Non-Cell-Autonomous Mode of DNA Damage Response in Soma of Caenorhabditis elegans.
Int J Mol Sci 2022 23(14)  
[ PubMed ID = 35886900 ] [ RRC reference ]

Ou HL, Schumacher B.
Evaluating DNA damage response through immunofluorescence staining of primordial germ cells in Caenorhabditis elegans L1 larva.
STAR Protoc 2021 2(2) 100441 
[ PubMed ID = 33899022 ] [ RRC reference ]

van der Woude M, Lans H.
C. elegans survival assays to discern global and transcription-coupled nucleotide excision repair.
STAR Protoc 2021 2(2) 100586 
[ PubMed ID = 34151304 ] [ RRC reference ]

Suehiro Y, Yoshina S, Motohashi T, Iwata S, Dejima K, Mitani S.
Efficient collection of a large number of mutations by mutagenesis of DNA damage response defective animals.
Sci Rep 2021 11(1) 7630 
[ PubMed ID = 33828169 ] [ RRC reference ]

Ou HL, Kim CS, Uszkoreit S, Wickström SA, Schumacher B.
Somatic Niche Cells Regulate the CEP-1/p53-Mediated DNA Damage Response in Primordial Germ Cells.
Dev Cell 2019 50(2) 167-183.e8 
[ PubMed ID = 31336098 ] [ RRC reference ]

Rieckher M, Bujarrabal A, Doll MA, Soltanmohammadi N, Schumacher B.
A simple answer to complex questions: Caenorhabditis elegans as an experimental model for examining the DNA damage response and disease genes.
J Cell Physiol 2018 233(4) 2781-2790 
[ PubMed ID = 28463453 ] [ RRC reference ]

Wilson DM 3rd, Rieckher M, Williams AB, Schumacher B.
Systematic analysis of DNA crosslink repair pathways during development and aging in Caenorhabditis elegans.
Nucleic Acids Res 2017 45(16) 9467-9480 
[ PubMed ID = 28934497 ] [ RRC reference ]

Edifizi D, Nolte H, Babu V, Castells-Roca L, Mueller MM, Brodesser S, Krüger M, Schumacher B.
Multilayered Reprogramming in Response to Persistent DNA Damage in C. elegans.
Cell Rep 2017 20(9) 2026-2043 
[ PubMed ID = 28854356 ] [ RRC reference ]

Babu V, Schumacher B.
A C. elegans homolog for the UV-hypersensitivity syndrome disease gene UVSSA.
DNA Repair (Amst) 2016 41 8-15 
[ PubMed ID = 27043179 ] [ RRC reference ]