| Allele Name | tm3785 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | T01C3.10 |
| Gene Name | nmr-2 |
| Worm Base | Allele Name |
tm3785
|
| Gene Name |
nmr-2
|
| Sequence |
T01C3.10
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable. |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 22601/22602-22949/22950 (348 bp deletion) |
| Chromosome | V |
| Putative gene structure | complement(join(19799..19883, 19933..20054, 20101..20205, 20253..20383, 20667..20848, 20898..20972, 21025..21116, 21159..21307, 21810..21881, 21983..22220, 22267..22462, 22509..22564, 22676..22936, Z81061.1:363..440, Z81061.1:483..621, Z81061.1:663..797, Z81061.1:843..1163, Z81061.1:1207..1229)) |
| Map position | 7.14 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtFwd:CGGAATTGTACTGTCGCGTC,IntFwd:TCGCCAAGGCAACATAGATA,ExtRev:CGCTTTGCTTCAACTACGAC,IntRev:CATTCCACGTGGATGACGGT |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Liu H, Wu JJ, Li R, Wang PZ, Huang JH, Xu Y, Zhao JL, Wu PP, Li SJ, Wu ZX. Disexcitation in the ASH/RIM/ADL negative feedback circuit fine-tunes hyperosmotic sensation and avoidance in Caenorhabditis elegans. Front Mol Neurosci 2023 16 1101628
[ PubMed ID = 37008778 ]
[ RRC reference ]
|
Rawsthorne H, Calahorro F, Holden-Dye L, O' Connor V, Dillon J. Investigating autism associated genes in C. elegans reveals candidates with a role in social behaviour. PLoS One 2021 16(5) e0243121
[ PubMed ID = 34043629 ]
[ RRC reference ]
|
Wen X, Chen YH, Li R, Ge MH, Yin SW, Wu JJ, Huang JH, Liu H, Wang PZ, Gross E, Wu ZX. Signal Decoding for Glutamate Modulating Egg Laying Oppositely in Caenorhabditiselegans under Varied Environmental Conditions. iScience 2020 23(10) 101588
[ PubMed ID = 33089099 ]
[ RRC reference ]
|
Saitoh Y, Katane M, Miyamoto T, Sekine M, Sakai-Kato K, Homma H. d-Serine and d-Alanine Regulate Adaptive Foraging Behavior in Caenorhabditis elegans via the NMDA Receptor. J Neurosci 2020 40(39) 7531-7544
[ PubMed ID = 32855271 ]
[ RRC reference ]
|
Lemieux GA, Cunningham KA, Lin L, Mayer F, Werb Z, Ashrafi K. Kynurenic acid is a nutritional cue that enables behavioral plasticity. Cell 2015 160(1-2) 119-31
[ PubMed ID = 25594177 ]
[ RRC reference ]
|
|