分離済み変異体

tm3785

Allele Nametm3785
BalanceNot Required
OutCrossNot Accepted
Sequence NameT01C3.10
Gene Namenmr-2
Worm BaseAllele Name tm3785
Gene Name nmr-2
Sequence T01C3.10
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 22601/22602-22949/22950 (348 bp deletion)
ChromosomeV
Putative gene structurecomplement(join(19799..19883, 19933..20054, 20101..20205, 20253..20383, 20667..20848, 20898..20972, 21025..21116, 21159..21307, 21810..21881, 21983..22220, 22267..22462, 22509..22564, 22676..22936, Z81061.1:363..440, Z81061.1:483..621, Z81061.1:663..797, Z81061.1:843..1163, Z81061.1:1207..1229))
Map position7.14
Balancer
Map position of balancer
Sequence of primersExtFwd:CGGAATTGTACTGTCGCGTC,IntFwd:TCGCCAAGGCAACATAGATA,ExtRev:CGCTTTGCTTCAACTACGAC,IntRev:CATTCCACGTGGATGACGGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Liu Y, Huang L, Wang R, Qi F, Liu Y, Chen Q, Mialon M, Chen L, Pinan-Lucarre B, Gao S.
Nicotine induces abnormal motor coupling through sensitization of a mechanosensory circuit in Caenorhabditis elegans.
PLoS Biol 2025 23(10) e3003423 
[ PubMed ID = 41042799 ] [ RRC reference ]

Liu H, Wu JJ, Li R, Wang PZ, Huang JH, Xu Y, Zhao JL, Wu PP, Li SJ, Wu ZX.
Disexcitation in the ASH/RIM/ADL negative feedback circuit fine-tunes hyperosmotic sensation and avoidance in Caenorhabditis elegans.
Front Mol Neurosci 2023 16 1101628 
[ PubMed ID = 37008778 ] [ RRC reference ]

Rawsthorne H, Calahorro F, Holden-Dye L, O' Connor V, Dillon J.
Investigating autism associated genes in C. elegans reveals candidates with a role in social behaviour.
PLoS One 2021 16(5) e0243121 
[ PubMed ID = 34043629 ] [ RRC reference ]

Wen X, Chen YH, Li R, Ge MH, Yin SW, Wu JJ, Huang JH, Liu H, Wang PZ, Gross E, Wu ZX.
Signal Decoding for Glutamate Modulating Egg Laying Oppositely in Caenorhabditiselegans under Varied Environmental Conditions.
iScience 2020 23(10) 101588 
[ PubMed ID = 33089099 ] [ RRC reference ]

Saitoh Y, Katane M, Miyamoto T, Sekine M, Sakai-Kato K, Homma H.
d-Serine and d-Alanine Regulate Adaptive Foraging Behavior in Caenorhabditis elegans via the NMDA Receptor.
J Neurosci 2020 40(39) 7531-7544 
[ PubMed ID = 32855271 ] [ RRC reference ]

Lemieux GA, Cunningham KA, Lin L, Mayer F, Werb Z, Ashrafi K.
Kynurenic acid is a nutritional cue that enables behavioral plasticity.
Cell 2015 160(1-2) 119-31 
[ PubMed ID = 25594177 ] [ RRC reference ]