Home > 分離済み変異体 > tm376

分離済み変異体

Allele Name		tm376
Balance		Not Required
OutCross		Not Accepted
Sequence Name		C14F5.1
Gene Name		dct-1
Worm Base	Allele Name	tm376
	Gene Name	dct-1
	Sequence	C14F5.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		23548/23549-24460/24461 (912 bp deletion)
Chromosome		X
Putative gene structure		join(24815..24977, 25160..25415, 25847..26017, 26068..26110)
Map position		-0.84
Balancer
Map position of balancer
Sequence of primers		ExtFwd:ACAGAGAGCGTCTGTGTTTG,IntFwd:TTCGCCGCAAGTTTATTGGC,IntRev:TCAAGGGAGATCGAGTGTAC,ExtRev:ATGATTCCTGTCGGATGCGC
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Ganguly U, Carroll T, Nehrke K, Johnson GVW. Mitochondrial Quality Control in Alzheimer's Disease: Insights from Caenorhabditis elegans Models. Antioxidants (Basel) 2024 13(11)   [ PubMed ID = 39594485 ] [ RRC reference ] Leuthner TC, Benzing L, Kohrn BF, Bergemann CM, Hipp MJ, Hershberger KA, Mello DF, Sokolskyi T, Stevenson K, Merutka IR, Seay SA, Gregory SG, Kennedy SR, Meyer JN. Resistance of mitochondrial DNA to cadmium and Aflatoxin B1 damage-induced germline mutation accumulation in C. elegans. Nucleic Acids Res 2022 50(15) 8626-8642  [ PubMed ID = 35947695 ] [ RRC reference ] Zaninello M, Palikaras K, Naon D, Iwata K, Herkenne S, Quintana-Cabrera R, Semenzato M, Grespi F, Ross-Cisneros FN, Carelli V, Sadun AA, Tavernarakis N, Scorrano L. Inhibition of autophagy curtails visual loss in a model of autosomal dominant optic atrophy. Nat Commun 2020 11(1) 4029  [ PubMed ID = 32788597 ] [ RRC reference ] Oh KH, Sheoran S, Richmond JE, Kim H. Alcohol induces mitochondrial fragmentation and stress responses to maintain normal muscle function in Caenorhabditis elegans. FASEB J 2020 34(6) 8204-8216  [ PubMed ID = 32294300 ] [ RRC reference ] Aspernig H, Heimbucher T, Qi W, Gangurde D, Curic S, Yan Y, Donner von Gromoff E, Baumeister R, Thien A. Mitochondrial Perturbations Couple mTORC2 to Autophagy in C. elegans. Cell Rep 2019 29(6) 1399-1409.e5  [ PubMed ID = 31693882 ] [ RRC reference ] Fang EF, Hou Y, Palikaras K, Adriaanse BA, Kerr JS, Yang B, Lautrup S, Hasan-Olive MM, Caponio D, Dan X, Rocktäschel P, Croteau DL, Akbari M, Greig NH, Fladby T, Nilsen H, Cader MZ, Mattson MP, Tavernarakis N, Bohr VA. Mitophagy inhibits amyloid-β and tau pathology and reverses cognitive deficits in models of Alzheimer's disease. Nat Neurosci 2019 22(3) 401-412  [ PubMed ID = 30742114 ] [ RRC reference ] Schiavi A, Maglioni S, Palikaras K, Shaik A, Strappazzon F, Brinkmann V, Torgovnick A, Castelein N, De Henau S, Braeckman BP, Cecconi F, Tavernarakis N, Ventura N. Iron-Starvation-Induced Mitophagy Mediates Lifespan Extension upon Mitochondrial Stress in C. elegans. Curr Biol 2015 25(14) 1810-22  [ PubMed ID = 26144971 ] [ RRC reference ] Palikaras K, Lionaki E, Tavernarakis N. Coordination of mitophagy and mitochondrial biogenesis during ageing in C. elegans. Nature 2015 521(7553) 525-8  [ PubMed ID = 25896323 ] [ RRC reference ]