Allele Name | tm3748 |
Allele Type | 通常株 |
Sequence Name | B0379.3 |
Gene Name | mut-16 |
Worm Base | Allele Name |
tm3748
|
Gene Name |
mut-16
|
Sequence |
B0379.3
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| homozygous viable. |
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 15507/15508-16058/16059 (551 bp deletion) |
Chromosome | I |
Putative gene structure | join(13467..13706, 13751..13873, 13915..14094, 14141..14265, 14718..15109, 15160..15282, 15328..15440, 15521..15950, 16150..16458, 16509..16692, 17655..18378, 18672..18824) |
Map position | 4.59 |
Balancer | |
Map position of balancer | |
Sequence of primers | ExtFwd:TGACTATTGTGCCGATTCAC,IntRev:AGGCGGAATATCGTTGGTGT,ExtRev:GGGAGAGCTACATTCACAGT,IntFwd:TCGATCGGTGGTGTTTCCTC |
Distributed lab | |
Depositor | Dr. S. Mitani/NBRP |
References |
Please submit your publication
Kim KW, Tang NH, Andrusiak MG, Wu Z, Chisholm AD, Jin Y. A Neuronal piRNA Pathway Inhibits Axon Regeneration in C. elegans. Neuron 2018 97(3) 511-519.e6
[ PubMed ID = 29395906 ]
[ RRC reference ]
|
Tsai HY, Chen CC, Conte D Jr, Moresco JJ, Chaves DA, Mitani S, Yates JR 3rd, Tsai MD, Mello CC. A ribonuclease coordinates siRNA amplification and mRNA cleavage during RNAi. Cell 2015 160(3) 407-19
[ PubMed ID = 25635455 ]
[ RRC reference ]
|
|