分離済み変異体

tm3735

Allele Nametm3735
BalanceNot Required
OutCrossNot Accepted
Sequence NameC06H2.3
Gene Namejmjd-5
Worm BaseAllele Name tm3735
Gene Name jmjd-5
Sequence C06H2.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 7064/7065-AA-7685/7686 (621 bp deletion + 2 bp insertion)
ChromosomeV
Putative gene structurejoin(5980..6130, 6178..6257, 6335..6465, 6513..6617, 6663..6753, 6874..7164, 7216..7656, 7701..7982, 8352..8516)
Map position2.95
Balancer
Map position of balancer
Sequence of primersIntRev:GGCGATGTTGTGCAAGATAG,ExtFwd:ACGAGTGTCGCGACGGAGTT,ExtRev:CCTGTGGCCCAATCCACATA,IntFwd:CTGTCCGGAGAGCATGGAAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Zaghet N, Madsen K, Rossi F, Perez DF, Amendola PG, Demharter S, Pfisterer U, Khodosevich K, Pasini D, Salcini AE.
Coordinated maintenance of H3K36/K27 methylation by histone demethylases preserves germ cell identity and immortality.
Cell Rep 2021 37(8) 110050 
[ PubMed ID = 34818537 ] [ RRC reference ]

Amendola PG, Zaghet N, Ramalho JJ, Vilstrup Johansen J, Boxem M, Salcini AE.
JMJD-5/KDM8 regulates H3K36me2 and is required for late steps of homologous recombination and genome integrity.
PLoS Genet 2017 13(2) e1006632 
[ PubMed ID = 28207814 ] [ RRC reference ]