分離済み変異体

tm373

Allele Nametm373
BalanceNot Required
OutCrossNot Accepted
Sequence NameC48D1.3
Gene Namecho-1
Worm BaseAllele Name tm373
Gene Name cho-1
Sequence C48D1.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. S. McIntire: normal locomotion and egg laying. Dr. J. Rand: moderate aldicarb resistence, slow thrashing, fatiques when swimming.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 18992/18993-20687/20688 (1695 bp deletion)
ChromosomeIV
Putative gene structurecomplement(join(16940..17126, 18419..18597, 18985..19442, 19553..19879, 19925..19961, 20333..20481, 20789..20987, 21037..21152, 21373..21616))
Map position8.47
Balancer
Map position of balancer
Sequence of primersIntFwd:AGGTCTCACTACTAACAGCA,IntRev:ATGGGCGGGTAGAAAATCGA,ExtFwd:GGGGGAATTGCATTCCGTCA,ExtRev:GTGCTCATTCTTGTCGTTGG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Li R, Xu Y, Wen X, Chen YH, Wang PZ, Zhao JL, Wu PP, Wu JJ, Liu H, Huang JH, Li SJ, Wu ZX.
GCY-20 signaling controls suppression of Caenorhabditis elegans egg laying by moderate cold.
Cell Rep 2024 43(2) 113708 
[ PubMed ID = 38294902 ] [ RRC reference ]

De-Souza EA, Thompson MA, Taylor RC.
Olfactory chemosensation extends lifespan through TGF-β signaling and UPR activation.
Nat Aging 2023 3(8) 938-947 
[ PubMed ID = 37500972 ] [ RRC reference ]

Wen X, Chen YH, Li R, Ge MH, Yin SW, Wu JJ, Huang JH, Liu H, Wang PZ, Gross E, Wu ZX.
Signal Decoding for Glutamate Modulating Egg Laying Oppositely in Caenorhabditiselegans under Varied Environmental Conditions.
iScience 2020 23(10) 101588 
[ PubMed ID = 33089099 ] [ RRC reference ]

Wang H, Salter CG, Refai O, Hardy H, Barwick KES, Akpulat U, Kvarnung M, Chioza BA, Harlalka G, Taylan F, Sejersen T, Wright J, Zimmerman HH, Karakaya M, Stüve B, Weis J, Schara U, Russell MA, Abdul-Rahman OA, Chilton J, Blakely RD, Baple EL, Cirak S, Crosby AH.
Choline transporter mutations in severe congenital myasthenic syndrome disrupt transporter localization.
Brain 2017 140(11) 2838-2850 
[ PubMed ID = 29088354 ] [ RRC reference ]

Mullen GP, Mathews EA, Vu MH, Hunter JW, Frisby DL, Duke A, Grundahl K, Osborne JD, Crowell JA, Rand JB.
Choline transport and de novo choline synthesis support acetylcholine biosynthesis in Caenorhabditis elegans cholinergic neurons.
Genetics 2007 177(1) 195-204 
[ PubMed ID = 17603106 ] [ RRC reference ]

Rand JB.
Acetylcholine.
WormBook 2007  1-21 
[ PubMed ID = 18050502 ] [ RRC reference ]

Matthies DS, Fleming PA, Wilkes DM, Blakely RD.
The Caenorhabditis elegans choline transporter CHO-1 sustains acetylcholine synthesis and motor function in an activity-dependent manner.
J Neurosci 2006 26(23) 6200-12 
[ PubMed ID = 16763028 ] [ RRC reference ]

Kim H, Rogers MJ, Richmond JE, McIntire SL.
SNF-6 is an acetylcholine transporter interacting with the dystrophin complex in Caenorhabditis elegans.
Nature 2004 430(7002) 891-6 
[ PubMed ID = 15318222 ] [ RRC reference ]