分離済み変異体

tm3713

Allele Nametm3713
BalanceNot Required
OutCrossNot Accepted
Sequence NameF29B9.2
Gene Namejmjd-1.2
Worm BaseAllele Name tm3713
Gene Name jmjd-1.2
Sequence F29B9.2
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. A. Salcini: Mol Cell. 38, 165 (2010).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 15767/15768-16342/16343 (575 bp deletion)
ChromosomeIV
Putative gene structurejoin(15142..15324, 15372..15443, 15490..15528, 15586..15774, 15939..16341, 16396..16522, 16881..17201, 17254..17485, 17804..18176, 18231..18968, 19019..19074)
Map position0.59
Balancer
Map position of balancer
Sequence of primersExtFwd:CACATCTCCTCGAGGCTTAC,IntFwd:ATCAGCATTCCGACCATAAG,ExtRev:CCTTACGGTGAGGGAACAGT,IntRev:GAGATGCTTCTCGTTCGGAC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Abay-Nørgaard S, Attianese B, Boreggio L, Salcini AE.
Regulators of H3K4 methylation mutated in neurodevelopmental disorders control axon guidance in Caenorhabditis elegans.
Development 2020 147(15)  
[ PubMed ID = 32675280 ] [ RRC reference ]

Mutlu B, Chen HM, Gutnik S, Hall DH, Keppler-Ross S, Mango SE.
Distinct functions and temporal regulation of methylated histone H3 during early embryogenesis.
Development 2019 146(19)  
[ PubMed ID = 31540912 ] [ RRC reference ]

Myers TR, Amendola PG, Lussi YC, Salcini AE.
JMJD-1.2 controls multiple histone post-translational modifications in germ cells and protects the genome from replication stress.
Sci Rep 2018 8(1) 3765 
[ PubMed ID = 29491442 ] [ RRC reference ]

Riveiro AR, Mariani L, Malmberg E, Amendola PG, Peltonen J, Wong G, Salcini AE.
JMJD-1.2/PHF8 controls axon guidance by regulating Hedgehog-like signaling.
Development 2017 144(5) 856-865 
[ PubMed ID = 28126843 ] [ RRC reference ]

Mariani L, Lussi YC, Vandamme J, Riveiro A, Salcini AE.
The H3K4me3/2 histone demethylase RBR-2 controls axon guidance by repressing the actin-remodeling gene wsp-1.
Development 2016 143(5) 851-63 
[ PubMed ID = 26811384 ] [ RRC reference ]

Vandamme J, Sidoli S, Mariani L, Friis C, Christensen J, Helin K, Jensen ON, Salcini AE.
H3K23me2 is a new heterochromatic mark in Caenorhabditis elegans.
Nucleic Acids Res 2015 43(20) 9694-710 
[ PubMed ID = 26476455 ] [ RRC reference ]

Greer EL, Beese-Sims SE, Brookes E, Spadafora R, Zhu Y, Rothbart SB, Aristizábal-Corrales D, Chen S, Badeaux AI, Jin Q, Wang W, Strahl BD, Colaiácovo MP, Shi Y.
A histone methylation network regulates transgenerational epigenetic memory in C. elegans.
Cell Rep 2014 7(1) 113-26 
[ PubMed ID = 24685137 ] [ RRC reference ]

Lin H, Wang Y, Wang Y, Tian F, Pu P, Yu Y, Mao H, Yang Y, Wang P, Hu L, Lin Y, Liu Y, Xu Y, Chen CD.
Coordinated regulation of active and repressive histone methylations by a dual-specificity histone demethylase ceKDM7A from Caenorhabditis elegans.
Cell Res 2010 20(8) 899-907 
[ PubMed ID = 20567262 ] [ RRC reference ]

Kleine-Kohlbrecher D, Christensen J, Vandamme J, Abarrategui I, Bak M, Tommerup N, Shi X, Gozani O, Rappsilber J, Salcini AE, Helin K.
A functional link between the histone demethylase PHF8 and the transcription factor ZNF711 in X-linked mental retardation.
Mol Cell 2010 38(2) 165-78 
[ PubMed ID = 20346720 ] [ RRC reference ]