| Allele Name | tm3706 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | Y55B1AR.1 |
| Gene Name | lec-6 |
| Worm Base | Allele Name |
tm3706
|
| Gene Name |
lec-6
|
| Sequence |
Y55B1AR.1
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable. |
|
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 12837/12838-GA-13238/13239 (401 bp deletion + 2 bp insertion) |
| Chromosome | III |
| Putative gene structure | Complement(join(13171..12848, 12530..12414) |
| Map position | -26.71 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtFwd:GTCTGGCACCACGTGCTTTG,IntFwd:ACGAACACAGTCCGCCTTAA,ExtRev:CCCCCAGTAGACACCGAGAA,IntRev:CGAGGGTTTTTCATACGCTC |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Wang B, Wang H, Xiong J, Zhou Q, Wu H, Xia L, Li L, Yu Z.
A Proteomic Analysis Provides Novel Insights into the Stress Responses of Caenorhabditis elegans towards Nematicidal Cry6A Toxin from Bacillus thuringiensis.
Sci Rep 2017 7(1) 14170
[ PubMed ID = 29074967 ]
[ RRC reference ]
|
Maduzia LL, Yu E, Zhang Y.
Caenorhabditis elegans galectins LEC-6 and LEC-10 interact with similar glycoconjugates in the intestine.
J Biol Chem 2011 286(6) 4371-81
[ PubMed ID = 21115491 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.