| Allele Name | tm3659 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | Y49E10.20 |
| Gene Name | Y49E10.20 |
| Worm Base | Allele Name |
tm3659
|
| Gene Name |
Y49E10.20
|
| Sequence |
Y49E10.20
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable. |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 86970/86971-87664/87665 (694 bp deletion) |
| Chromosome | III |
| Putative gene structure | complement(join(86322..86411, 86465..86660, 86709..86952, 87032..87413, 87518..87646, 87943..88192, 89068..89255, 89317..89442)) |
| Map position | 17.88 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | IntFwd:TTCGTCGGATTGTCGCTGTA,ExtRev:AATGGTCTCCGAGGCTCCGT,ExtFwd:CCAGCACAAGACGTCCGTAC,IntRev:GGCTCCGTATATTACGGTAT |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Fang J, Wang J, Wang Y, Liu X, Chen B, Zou W. Ribo-On and Ribo-Off tools using a self-cleaving ribozyme allow manipulation of endogenous gene expression in C. elegans. Commun Biol 2023 6(1) 816
[ PubMed ID = 37542105 ]
[ RRC reference ]
|
Corrionero A, Horvitz HR. A C9orf72 ALS/FTD Ortholog Acts in Endolysosomal Degradation and Lysosomal Homeostasis. Curr Biol 2018 28(10) 1522-1535.e5
[ PubMed ID = 29731301 ]
[ RRC reference ]
|
Li Y, Chen B, Zou W, Wang X, Wu Y, Zhao D, Sun Y, Liu Y, Chen L, Miao L, Yang C, Wang X. The lysosomal membrane protein SCAV-3 maintains lysosome integrity and adult longevity. J Cell Biol 2016 215(2) 167-185
[ PubMed ID = 27810910 ]
[ RRC reference ]
|
|