分離済み変異体

tm3624

Allele Nametm3624
BalanceNot Required
OutCrossNot Accepted
Sequence NameF43D9.4
Gene Namesip-1
Worm BaseAllele Name tm3624
Gene Name sip-1
Sequence F43D9.4
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. I. Mori: weakly abnormal thermotaxis (raised at 23 C).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 18538/18539-18820/18821 (282 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(18010..18211, 18268..18545))
Map position2.91
Balancer
Map position of balancer
Sequence of primersExtRev:GAAGCGTGTCAAACGGTGTA,IntFwd:CCTGGCAGTATGTAATCTAG,IntRev:ACACTGGCGCATTTTGCGTG,ExtFwd:GACTCCCCCCTGTACCCAAA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Cornwell AB, Zhang Y, Thondamal M, Johnson DW, Thakar J, Samuelson AV.
The C. elegans Myc-family of transcription factors coordinate a dynamic adaptive response to dietary restriction.
Geroscience 2024 46(5) 4827-4854 
[ PubMed ID = 38878153 ] [ RRC reference ]

Cornwell A, Zhang Y, Thondamal M, Johnson DW, Thakar J, Samuelson AV.
The C. elegans Myc-family of transcription factors coordinate a dynamic adaptive response to dietary restriction.
bioRxiv 2023   
[ PubMed ID = 38045350 ] [ RRC reference ]

Chung KW, Kim JS, Lee KS.
A Database of Caenorhabditis elegans Locomotion and Body Posture Phenotypes for the Peripheral Neuropathy Model.
Mol Cells 2020 43(10) 880-888 
[ PubMed ID = 33115980 ] [ RRC reference ]

Fleckenstein T, Kastenmüller A, Stein ML, Peters C, Daake M, Krause M, Weinfurtner D, Haslbeck M, Weinkauf S, Groll M, Buchner J.
The Chaperone Activity of the Developmental Small Heat Shock Protein Sip1 Is Regulated by pH-Dependent Conformational Changes.
Mol Cell 2015 58(6) 1067-78 
[ PubMed ID = 26009280 ] [ RRC reference ]