Home > 分離済み変異体 > tm3620

分離済み変異体

Allele Name		tm3620
Balance		Not Required
OutCross		Not Accepted
Sequence Name		ZK75.1
Gene Name		ins-4
Worm Base	Allele Name	tm3620
	Gene Name	ins-4
	Sequence	ZK75.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable. Dr. Q.L. Ch'ng: non-Unc, non-Pvl, non-Lon, non-Sma, non-Dpy.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		17584/17585-17737/17738 (153 bp deletion)
Chromosome		II
Putative gene structure		join(17500..17734, 17793..17878)
Map position		-0.73
Balancer
Map position of balancer
Sequence of primers		ExtRev:GATGGCTTGTTGGACGACTG,IntRev:GAGTGCACTGTGTTGTGCAG,ExtFwd:CCGCCCAATCCCTTTAACGT,IntFwd:TGGCGCTTGACGCATCAGTC
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Podraza-Farhanieh A, Raj D, Kao G, Naredi P. A proinsulin-dependent interaction between ENPL-1 and ASNA-1 in neurons is required to maintain insulin secretion in C. elegans. Development 2023 150(6)   [ PubMed ID = 36939052 ] [ RRC reference ] Matty MA, Lau HE, Haley JA, Singh A, Chakraborty A, Kono K, Reddy KC, Hansen M, Chalasani SH. Intestine-to-neuronal signaling alters risk-taking behaviors in food-deprived Caenorhabditis elegans. PLoS Genet 2022 18(5) e1010178  [ PubMed ID = 35511794 ] [ RRC reference ] Schiffer JA, Servello FA, Heath WR, Amrit FRG, Stumbur SV, Eder M, Martin OM, Johnsen SB, Stanley JA, Tam H, Brennan SJ, McGowan NG, Vogelaar AL, Xu Y, Serkin WT, Ghazi A, Stroustrup N, Apfeld J. Caenorhabditis elegans processes sensory information to choose between freeloading and self-defense strategies. Elife 2020 9   [ PubMed ID = 32367802 ] [ RRC reference ] Wu T, Duan F, Yang W, Liu H, Caballero A, Fernandes de Abreu DA, Dar AR, Alcedo J, Ch'ng Q, Butcher RA, Zhang Y. Pheromones Modulate Learning by Regulating the Balanced Signals of Two Insulin-like Peptides. Neuron 2019 104(6) 1095-1109.e5  [ PubMed ID = 31676170 ] [ RRC reference ] Kaplan REW, Maxwell CS, Codd NK, Baugh LR. Pervasive Positive and Negative Feedback Regulation of Insulin-Like Signaling in Caenorhabditis elegans. Genetics 2019 211(1) 349-361  [ PubMed ID = 30425043 ] [ RRC reference ] Ryu L, Cheon Y, Huh YH, Pyo S, Chinta S, Choi H, Butcher RA, Kim K. Feeding state regulates pheromone-mediated avoidance behavior via the insulin signaling pathway in Caenorhabditis elegans. EMBO J 2018 37(15)   [ PubMed ID = 29925517 ] [ RRC reference ] Lee D, Lee H, Kim N, Lim DS, Lee J. Regulation of a hitchhiking behavior by neuronal insulin and TGF-β signaling in the nematode Caenorhabditis elegans. Biochem Biophys Res Commun 2017 484(2) 323-330  [ PubMed ID = 28131836 ] [ RRC reference ] Chen Y, Baugh LR. Ins-4 and daf-28 function redundantly to regulate C. elegans L1 arrest. Dev Biol 2014 394(2) 314-26  [ PubMed ID = 25128585 ] [ RRC reference ] Hung WL, Wang Y, Chitturi J, Zhen M. A Caenorhabditis elegans developmental decision requires insulin signaling-mediated neuron-intestine communication. Development 2014 141(8) 1767-79  [ PubMed ID = 24671950 ] [ RRC reference ] Fernandes de Abreu DA, Caballero A, Fardel P, Stroustrup N, Chen Z, Lee K, Keyes WD, Nash ZM, López-Moyado IF, Vaggi F, Cornils A, Regenass M, Neagu A, Ostojic I, Liu C, Cho Y, Sifoglu D, Shen Y, Fontana W, Lu H, Csikasz-Nagy A, Murphy CT, Antebi A, Blanc E, Apfeld J, Zhang Y, Alcedo J, Ch'ng Q. An insulin-to-insulin regulatory network orchestrates phenotypic specificity in development and physiology. PLoS Genet 2014 10(3) e1004225  [ PubMed ID = 24675767 ] [ RRC reference ] Baugh LR, Kurhanewicz N, Sternberg PW. Sensitive and precise quantification of insulin-like mRNA expression in Caenorhabditis elegans. PLoS One 2011 6(3) e18086  [ PubMed ID = 21445366 ] [ RRC reference ]