分離済み変異体

tm3618

Allele Nametm3618
BalanceNot Required
OutCrossNot Accepted
Sequence NameC06E2.8
Gene Nameins-9
Worm BaseAllele Name tm3618
Gene Name ins-9
Sequence C06E2.8
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. Q.L. Ch'ng: non-Unc, non-Pvl, non-Lon, non-Sma, non-Dpy.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 15546/15547-CACACAGCTTAGAGAGATCCTGTTCCGT-15757/15758 (211 bp deletion + 28 bp insertion)
ChromosomeX
Putative gene structurecomplement(join(15699..15785, 15832..16101))
Map position0.44
Balancer
Map position of balancer
Sequence of primersIntRev:AGGAGTGAAACGATGATCGT,ExtRev:ATGTCCCGCCCCAAATGTTG,IntFwd:CAGATGGCTCGTAGGGACAA,ExtFwd:GTATTAGGTAGTAGGCTGTC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Zhang MG, Seyedolmohadesin M, Mercado SH, Tauffenberger A, Park H, Finnen N, Schroeder FC, Venkatachalam V, Sternberg PW.
Sensory integration of food and population density during the diapause exit decision involves insulin-like signaling in Caenorhabditis elegans.
Proc Natl Acad Sci U S A 2024 121(40) e2405391121 
[ PubMed ID = 39316052 ] [ RRC reference ]

Zhang MG, Seyedolmohadesin M, Hawk S, Park H, Finnen N, Schroeder F, Venkatachalam V, Sternberg PW.
Sensory integration of food availability and population density during the diapause exit decision involves insulin-like signaling in Caenorhabditis elegans.
bioRxiv 2024   
[ PubMed ID = 38586049 ] [ RRC reference ]

Delaney CE, Chen AT, Graniel JV, Dumas KJ, Hu PJ.
A histone H4 lysine 20 methyltransferase couples environmental cues to sensory neuron control of developmental plasticity.
Development 2017 144(7) 1273-1282 
[ PubMed ID = 28209779 ] [ RRC reference ]

Lee D, Lee H, Kim N, Lim DS, Lee J.
Regulation of a hitchhiking behavior by neuronal insulin and TGF-β signaling in the nematode Caenorhabditis elegans.
Biochem Biophys Res Commun 2017 484(2) 323-330 
[ PubMed ID = 28131836 ] [ RRC reference ]

Chen Y, Baugh LR.
Ins-4 and daf-28 function redundantly to regulate C. elegans L1 arrest.
Dev Biol 2014 394(2) 314-26 
[ PubMed ID = 25128585 ] [ RRC reference ]

Fernandes de Abreu DA, Caballero A, Fardel P, Stroustrup N, Chen Z, Lee K, Keyes WD, Nash ZM, López-Moyado IF, Vaggi F, Cornils A, Regenass M, Neagu A, Ostojic I, Liu C, Cho Y, Sifoglu D, Shen Y, Fontana W, Lu H, Csikasz-Nagy A, Murphy CT, Antebi A, Blanc E, Apfeld J, Zhang Y, Alcedo J, Ch'ng Q.
An insulin-to-insulin regulatory network orchestrates phenotypic specificity in development and physiology.
PLoS Genet 2014 10(3) e1004225 
[ PubMed ID = 24675767 ] [ RRC reference ]