分離済み変異体

tm3608

Allele Nametm3608
BalanceNot Required
OutCrossNot Accepted
Sequence NameZK75.3
Gene Nameins-3
Worm BaseAllele Name tm3608
Gene Name ins-3
Sequence ZK75.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. Q.L. Ch'ng, Dr. J. Kaplan: non-Unc, non-Pvl, non-Lon, non-Sma, non-Dpy.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 11710/11711-CCAATTTCCGAATCAATCATC-11890/11891 (180 bp deletion + 21 bp insertion)
ChromosomeII
Putative gene structurecomplement(join(11412..11497, 11579..11816))
Map position-0.75
Balancer
Map position of balancer
Sequence of primersIntFwd:GGCATGTAATGTAGGGGTAA,ExtRev:GATCAGCATTGTCACCTGAC,IntRev:CTGAATTGCCGTCACGCCTT,ExtFwd:TGGCAACTGATGTCCGGTAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Le TA, Temmerman L, Roy C.
Nictation behavior in nematodes.
BMC Biol 2025 23(1) 356 
[ PubMed ID = 41350688 ] [ RRC reference ]

Schiffer JA, Servello FA, Heath WR, Amrit FRG, Stumbur SV, Eder M, Martin OM, Johnsen SB, Stanley JA, Tam H, Brennan SJ, McGowan NG, Vogelaar AL, Xu Y, Serkin WT, Ghazi A, Stroustrup N, Apfeld J.
Caenorhabditis elegans processes sensory information to choose between freeloading and self-defense strategies.
Elife 2020 9  
[ PubMed ID = 32367802 ] [ RRC reference ]

Wu T, Duan F, Yang W, Liu H, Caballero A, Fernandes de Abreu DA, Dar AR, Alcedo J, Ch'ng Q, Butcher RA, Zhang Y.
Pheromones Modulate Learning by Regulating the Balanced Signals of Two Insulin-like Peptides.
Neuron 2019 104(6) 1095-1109.e5 
[ PubMed ID = 31676170 ] [ RRC reference ]

Lee D, Lee H, Kim N, Lim DS, Lee J.
Regulation of a hitchhiking behavior by neuronal insulin and TGF-β signaling in the nematode Caenorhabditis elegans.
Biochem Biophys Res Commun 2017 484(2) 323-330 
[ PubMed ID = 28131836 ] [ RRC reference ]

Burton NO, Furuta T, Webster AK, Kaplan RE, Baugh LR, Arur S, Horvitz HR.
Insulin-like signalling to the maternal germline controls progeny response to osmotic stress.
Nat Cell Biol 2017 19(3) 252-257 
[ PubMed ID = 28166192 ] [ RRC reference ]

Hung WL, Wang Y, Chitturi J, Zhen M.
A Caenorhabditis elegans developmental decision requires insulin signaling-mediated neuron-intestine communication.
Development 2014 141(8) 1767-79 
[ PubMed ID = 24671950 ] [ RRC reference ]

Fernandes de Abreu DA, Caballero A, Fardel P, Stroustrup N, Chen Z, Lee K, Keyes WD, Nash ZM, López-Moyado IF, Vaggi F, Cornils A, Regenass M, Neagu A, Ostojic I, Liu C, Cho Y, Sifoglu D, Shen Y, Fontana W, Lu H, Csikasz-Nagy A, Murphy CT, Antebi A, Blanc E, Apfeld J, Zhang Y, Alcedo J, Ch'ng Q.
An insulin-to-insulin regulatory network orchestrates phenotypic specificity in development and physiology.
PLoS Genet 2014 10(3) e1004225 
[ PubMed ID = 24675767 ] [ RRC reference ]