分離済み変異体

tm3603

Allele Nametm3603
BalanceNot Required
OutCrossNot Accepted
Sequence NameY54G2A.23
Gene NameY54G2A.23
Worm BaseAllele Name tm3603
Gene Name Y54G2A.23
Sequence Y54G2A.23
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 177676/177677-AAAATTTAAAAATTTTAAAG-177880/177881 (204 bp deletion + 20 bp insertion)
ChromosomeIV
Putative gene structurecomplement(join(177490..177656, 177724..177868, 177941..178065, 178128..178197))
Map position-6.72
Balancer
Map position of balancer
Sequence of primersIntRev:AGCCGACTCGTCCTTCTCAT,ExtFwd:TCGGCTTAAGCTCCTCGATG,IntFwd:CTCGGTGCATCCCTTGCACA,ExtRev:ACCCCGTAATAATCCCTGTT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Taylor SKB, Hartman JH, Gupta BP.
The neurotrophic factor MANF regulates autophagy and lysosome function to promote proteostasis in Caenorhabditis elegans.
Proc Natl Acad Sci U S A 2024 121(43) e2403906121 
[ PubMed ID = 39418305 ] [ RRC reference ]

Taylor SKB, Hartman JH, Gupta BP.
Neurotrophic factor MANF regulates autophagy and lysosome function to promote proteostasis in C. elegans.
bioRxiv 2024   
[ PubMed ID = 38260421 ] [ RRC reference ]

Matty MA, Lau HE, Haley JA, Singh A, Chakraborty A, Kono K, Reddy KC, Hansen M, Chalasani SH.
Intestine-to-neuronal signaling alters risk-taking behaviors in food-deprived Caenorhabditis elegans.
PLoS Genet 2022 18(5) e1010178 
[ PubMed ID = 35511794 ] [ RRC reference ]

Hartman JH, Richie CT, Gordon KL, Mello DF, Castillo P, Zhu A, Wang Y, Hoffer BJ, Sherwood DR, Meyer JN, Harvey BK.
MANF deletion abrogates early larval Caenorhabditis elegans stress response to tunicamycin and Pseudomonas aeruginosa.
Eur J Cell Biol 2019 98(5-8) 151043 
[ PubMed ID = 31138438 ] [ RRC reference ]

Richman C, Rashid S, Prashar S, Mishra R, Selvaganapathy PR, Gupta BP.
C. elegans MANF Homolog Is Necessary for the Protection of Dopaminergic Neurons and ER Unfolded Protein Response.
Front Neurosci 2018 12 544 
[ PubMed ID = 30147641 ] [ RRC reference ]

Bai M, Vozdek R, Hnízda A, Jiang C, Wang B, Kuchar L, Li T, Zhang Y, Wood C, Feng L, Dang Y, Ma DK.
Conserved roles of C. elegans and human MANFs in sulfatide binding and cytoprotection.
Nat Commun 2018 9(1) 897 
[ PubMed ID = 29497057 ] [ RRC reference ]