Allele Name | tm3574 |
Allele Type | 通常株 |
Sequence Name | C46F11.2 |
Gene Name | gsr-1 |
Worm Base | Allele Name |
tm3574
|
Gene Name |
gsr-1
|
Sequence |
C46F11.2
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| lethal or sterile. |
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 9752/9753-10135/10136 (383 bp deletion) |
Chromosome | III |
Putative gene structure | join(9164..9411, 9467..9824, 9875..10346, 10403..10704) |
Map position | -5 |
Balancer | |
Map position of balancer | |
Sequence of primers | ExtFwd:TCCGGGACCACGCTGATTAC,IntRev:TATACCTTCCGTGAGTCCGA,IntFwd:CGGATTTGATGTGACGCTTA,ExtRev:CCGTACTTTTCAACGGCCTC |
Distributed lab | |
Depositor | Dr. S. Mitani/NBRP |
References |
Please submit your publication
Lüersen K, Stegehake D, Daniel J, Drescher M, Ajonina I, Ajonina C, Hertel P, Woltersdorf C, Liebau E. The glutathione reductase GSR-1 determines stress tolerance and longevity in Caenorhabditis elegans. PLoS One 2013 8(4) e60731
[ PubMed ID = 23593298 ]
[ RRC reference ]
|
Mora-Lorca JA, Sáenz-Narciso B, Gaffney CJ, Naranjo-Galindo FJ, Pedrajas JR, Guerrero-Gómez D, Dobrzynska A, Askjaer P, Szewczyk NJ, Cabello J, Miranda-Vizuete A. Glutathione reductase gsr-1 is an essential gene required for Caenorhabditis elegans early embryonic development. Free Radic Biol Med 2016 96 446-61
[ PubMed ID = 27117030 ]
[ RRC reference ]
|
|