分離済み変異体

tm3569

Allele Nametm3569
BalanceCompleted
OutCrossNot Accepted
Sequence NameY48A6C.5
Gene Namepha-1
Worm BaseAllele Name tm3569 (x1)
Gene Name pha-1
Sequence Y48A6C.5
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 32128/32129-32696/32697 (568 bp deletion)
ChromosomeIII
Putative gene structurejoin(31284..31331, 31944..32335, 32388..32509, 32579..32747, 34723..35467)
Map position6.14
BalancerhT2 [bli-4(e937) let-? qIs48]
Map position of balancer
Sequence of primersExtFwd:CGTTGCTCGATGATTTCTCC,IntFwd:CCTTGCGAATAACATAGCAG,ExtRev:CGGTTGTCGCGCACTACTGA,IntRev:GCACTACTGAATCAGAGTCT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Polley SR, Kuzmanov A, Kuang J, Karpel J, Lažetić V, Karina EI, Veo BL, Fay DS.
Implicating SCF complexes in organogenesis in Caenorhabditis elegans.
Genetics 2014 196(1) 211-23 
[ PubMed ID = 24214340 ] [ RRC reference ]

Fay DS, Polley SR, Kuang J, Kuzmanov A, Hazel JW, Mani K, Veo BL, Yochem J.
A regulatory module controlling pharyngeal development and function in Caenorhabditis elegans.
Genetics 2012 191(3) 827-43 
[ PubMed ID = 22542967 ] [ RRC reference ]

Mani K, Fay DS.
A mechanistic basis for the coordinated regulation of pharyngeal morphogenesis in Caenorhabditis elegans by LIN-35/Rb and UBC-18-ARI-1.
PLoS Genet 2009 5(6) e1000510 
[ PubMed ID = 19521497 ] [ RRC reference ]