| Allele Name | tm3569 |
| Balance | Completed |
| OutCross | Not Accepted |
| Sequence Name | Y48A6C.5 |
| Gene Name | pha-1 |
| Worm Base | Allele Name |
tm3569
(x1) |
| Gene Name |
pha-1
|
| Sequence |
Y48A6C.5
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| lethal or sterile. |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 32128/32129-32696/32697 (568 bp deletion) |
| Chromosome | III |
| Putative gene structure | join(31284..31331, 31944..32335, 32388..32509, 32579..32747, 34723..35467) |
| Map position | 6.14 |
| Balancer | hT2 [bli-4(e937) let-? qIs48] |
| Map position of balancer | |
| Sequence of primers | ExtFwd:CGTTGCTCGATGATTTCTCC,IntFwd:CCTTGCGAATAACATAGCAG,ExtRev:CGGTTGTCGCGCACTACTGA,IntRev:GCACTACTGAATCAGAGTCT |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Polley SR, Kuzmanov A, Kuang J, Karpel J, Lažetić V, Karina EI, Veo BL, Fay DS. Implicating SCF complexes in organogenesis in Caenorhabditis elegans. Genetics 2014 196(1) 211-23
[ PubMed ID = 24214340 ]
[ RRC reference ]
|
Fay DS, Polley SR, Kuang J, Kuzmanov A, Hazel JW, Mani K, Veo BL, Yochem J. A regulatory module controlling pharyngeal development and function in Caenorhabditis elegans. Genetics 2012 191(3) 827-43
[ PubMed ID = 22542967 ]
[ RRC reference ]
|
Mani K, Fay DS. A mechanistic basis for the coordinated regulation of pharyngeal morphogenesis in Caenorhabditis elegans by LIN-35/Rb and UBC-18-ARI-1. PLoS Genet 2009 5(6) e1000510
[ PubMed ID = 19521497 ]
[ RRC reference ]
|
|