分離済み変異体

tm355

Allele Nametm355
BalanceNot Required
OutCrossNot Accepted
Sequence NameF45H11.4
Gene Namemgl-2
Worm BaseAllele Name tm355
Gene Name mgl-2
Sequence F45H11.4
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. C.L. Creasy: fertile, normal locomotion, normal egg-laying, solitary social feeding. Dr. I. Mori: normal thermotaxis. Dr. K. Ashrafi: normal Sudan Black B staining. Dr. M. Chalfie: normal touch sensitivity. Dr. L. Avery: Genes & Dev. 23, 12 (2009)
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 28272/28273-28543/28544 (271 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(23619..23675, 24706..24918, 24971..25071, 25260..25363, 25593..25895, 26043..26299, 26643..27155, 27408..27594, 27876..28010, 28060..28230, 28503..28950, 29655..29826, 29877..30054, 30103..30257, 432..617))
Map position4.97
Balancer
Map position of balancer
Sequence of primersExtFwd:TTTGGCCATGAGCCAAGAGT,IntFwd:AGCAACACGCCATTGTTTCT,IntRev:CGGATTGTCTGGCATATACA,ExtRev:ATTCAGCAGGTAAATCTCCG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Dustin A, Dwyer D.
Suicide risk genes impact evolutionarily conserved survival strategies.
Res Sq 2025   
[ PubMed ID = 41282132 ] [ RRC reference ]

Lin C, Shan Y, Wang Z, Peng H, Li R, Wang P, He J, Shen W, Wu Z, Guo M.
Molecular and circuit mechanisms underlying avoidance of rapid cooling stimuli in C. elegans.
Nat Commun 2024 15(1) 297 
[ PubMed ID = 38182628 ] [ RRC reference ]

Ajayi T, Thomas A, Nikolic M, Henderson L, Zaheri A, Dwyer DS.
Evolutionary conservation of putative suicidality-related risk genes that produce diminished motivation corrected by clozapine, lithium and antidepressants.
Front Psychiatry 2024 15 1341735 
[ PubMed ID = 38362034 ] [ RRC reference ]

Woodhouse RM, Frolows N, Wang G, Hawdon A, Wong EHK, Dansereau LC, Su Y, Adair LD, New EJ, Philp AM, Tan WK, Philp A, Ashe A.
Mitochondrial succinate dehydrogenase function is essential for sperm motility and male fertility.
iScience 2022 25(12) 105573 
[ PubMed ID = 36465130 ] [ RRC reference ]

Motomura H, Ioroi M, Murakami K, Kuhara A, Ohta A.
Head-tail-head neural wiring underlies gut fat storage in Caenorhabditis elegans temperature acclimation.
Proc Natl Acad Sci U S A 2022 119(32) e2203121119 
[ PubMed ID = 35914124 ] [ RRC reference ]

Kang C, Avery L.
The FMRFamide Neuropeptide FLP-20 Acts as a Systemic Signal for Starvation Responses in Caenorhabditis elegans.
Mol Cells 2021 44(7) 529-537 
[ PubMed ID = 34140426 ] [ RRC reference ]

Wang M, Witvliet D, Wu M, Kang L, Shao Z.
Temperature regulates synaptic subcellular specificity mediated by inhibitory glutamate signaling.
PLoS Genet 2021 17(1) e1009295 
[ PubMed ID = 33428618 ] [ RRC reference ]

Wen X, Chen YH, Li R, Ge MH, Yin SW, Wu JJ, Huang JH, Liu H, Wang PZ, Gross E, Wu ZX.
Signal Decoding for Glutamate Modulating Egg Laying Oppositely in Caenorhabditiselegans under Varied Environmental Conditions.
iScience 2020 23(10) 101588 
[ PubMed ID = 33089099 ] [ RRC reference ]

Katz M, Corson F, Keil W, Singhal A, Bae A, Lu Y, Liang Y, Shaham S.
Glutamate spillover in C. elegans triggers repetitive behavior through presynaptic activation of MGL-2/mGluR5.
Nat Commun 2019 10(1) 1882 
[ PubMed ID = 31015396 ] [ RRC reference ]

Kuramochi M, Doi M.
An Excitatory/Inhibitory Switch From Asymmetric Sensory Neurons Defines Postsynaptic Tuning for a Rapid Response to NaCl in Caenorhabditis elegans.
Front Mol Neurosci 2018 11 484 
[ PubMed ID = 30687001 ] [ RRC reference ]

Jeong H, Paik YK.
MGL-1 on AIY neurons translates starvation to reproductive plasticity via neuropeptide signaling in Caenorhabditis elegans.
Dev Biol 2017 430(1) 80-89 
[ PubMed ID = 28807780 ] [ RRC reference ]

Bhatla N, Droste R, Sando SR, Huang A, Horvitz HR.
Distinct Neural Circuits Control Rhythm Inhibition and Spitting by the Myogenic Pharynx of C. elegans.
Curr Biol 2015 25(16) 2075-89 
[ PubMed ID = 26212880 ] [ RRC reference ]

Hardaway JA, Sturgeon SM, Snarrenberg CL, Li Z, Xu XZ, Bermingham DP, Odiase P, Spencer WC, Miller DM 3rd, Carvelli L, Hardie SL, Blakely RD.
Glial Expression of the Caenorhabditis elegans Gene swip-10 Supports Glutamate Dependent Control of Extrasynaptic Dopamine Signaling.
J Neurosci 2015 35(25) 9409-23 
[ PubMed ID = 26109664 ] [ RRC reference ]

Lemieux GA, Keiser MJ, Sassano MF, Laggner C, Mayer F, Bainton RJ, Werb Z, Roth BL, Shoichet BK, Ashrafi K.
In silico molecular comparisons of C. elegans and mammalian pharmacology identify distinct targets that regulate feeding.
PLoS Biol 2013 11(11) e1001712 
[ PubMed ID = 24260022 ] [ RRC reference ]

Hyde R, Corkins ME, Somers GA, Hart AC.
PKC-1 acts with the ERK MAPK signaling pathway to regulate Caenorhabditis elegans mechanosensory response.
Genes Brain Behav 2011 10(3) 286-98 
[ PubMed ID = 21143768 ] [ RRC reference ]

Kang C, Avery L.
Systemic regulation of starvation response in Caenorhabditis elegans.
Genes Dev 2009 23(1) 12-7 
[ PubMed ID = 19136622 ] [ RRC reference ]

Greer ER, Pérez CL, Van Gilst MR, Lee BH, Ashrafi K.
Neural and molecular dissection of a C. elegans sensory circuit that regulates fat and feeding.
Cell Metab 2008 8(2) 118-31 
[ PubMed ID = 18680713 ] [ RRC reference ]