分離済み変異体

tm3546

Allele Nametm3546
BalanceNot Required
OutCrossNot Accepted
Sequence NameY54G2A.31
Gene Nameubc-13
Worm BaseAllele Name tm3546 (x1)
Gene Name ubc-13
Sequence Y54G2A.31
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. Y. Jin: no movement defects, grow well.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 174972/174973-175206/175207 (234 bp deletion)
ChromosomeIV
Putative gene structurecomplement(join(172802..172809, 173983..174150, 175190..175469))
Map position-6.72
BalancertmC25[tmIs1241]
Map position of balancer
Sequence of primersExtRev:TCTTGCAGAATGGCCGGGCA,IntFwd:AGCCGGCGACCATTTATCTG,IntRev:GGGCAACTTCCGCGTCGAAT,ExtFwd:GACAGAAGAACCGTGCGAAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Kawasaki I, Sugiura K, Sasaki T, Matsuda N, Sato M, Sato K.
MARC-3, a membrane-associated ubiquitin ligase, is required for fast polyspermy block in Caenorhabditis elegans.
Nat Commun 2024 15(1) 792 
[ PubMed ID = 38278786 ] [ RRC reference ]

Zhang J, Liu J, Norris A, Grant BD, Wang X.
A novel requirement for ubiquitin-conjugating enzyme UBC-13 in retrograde recycling of MIG-14/Wntless and Wnt signaling.
Mol Biol Cell 2018 29(17) 2098-2112 
[ PubMed ID = 29927348 ] [ RRC reference ]

Liu J, Li M, Li L, Chen S, Wang X.
Ubiquitination of the PI3-kinase VPS-34 promotes VPS-34 stability and phagosome maturation.
J Cell Biol 2018 217(1) 347-360 
[ PubMed ID = 29092895 ] [ RRC reference ]

Sato M, Konuma R, Sato K, Tomura K, Sato K.
Fertilization-induced K63-linked ubiquitylation mediates clearance of maternal membrane proteins.
Development 2014 141(6) 1324-31 
[ PubMed ID = 24595290 ] [ RRC reference ]

Kramer LB, Shim J, Previtera ML, Isack NR, Lee MC, Firestein BL, Rongo C.
UEV-1 is an ubiquitin-conjugating enzyme variant that regulates glutamate receptor trafficking in C. elegans neurons.
PLoS One 2010 5(12) e14291 
[ PubMed ID = 21179194 ] [ RRC reference ]