分離済み変異体

tm3543

Allele Nametm3543
BalanceCompleted
OutCrossNot Accepted
Sequence NameF33G12.4
Gene Namelrr-1
Worm BaseAllele Name tm3543 (x1)
Gene Name lrr-1
Sequence F33G12.4
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 12446/12447-12934/12935 (488 bp deletion)
ChromosomeII
Putative gene structurecomplement(join(11426..11519, 11626..11841, 11894..12019, 12428..12639, 12689..13045, 13098..13181, 13232..13393, 13447..13557))
Map position-2.59
Balancer,mIn1 [e128 mIs14]
Map position of balancer
Sequence of primersExtFwd:CCGATCACGTCGACAGAATT,ExtRev:CGTGGCCGGTGACAAAACTG,IntFwd:CGAATATGCCGAAGTCTGAC,IntRev:AGCCGCCAATTATTCTCGAC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Matty MA, Lau HE, Haley JA, Singh A, Chakraborty A, Kono K, Reddy KC, Hansen M, Chalasani SH.
Intestine-to-neuronal signaling alters risk-taking behaviors in food-deprived Caenorhabditis elegans.
PLoS Genet 2022 18(5) e1010178 
[ PubMed ID = 35511794 ] [ RRC reference ]

Sonneville R, Moreno SP, Knebel A, Johnson C, Hastie CJ, Gartner A, Gambus A, Labib K.
CUL-2LRR-1 and UBXN-3 drive replisome disassembly during DNA replication termination and mitosis.
Nat Cell Biol 2017 19(5) 468-479 
[ PubMed ID = 28368371 ] [ RRC reference ]

Ossareh-Nazari B, Katsiarimpa A, Merlet J, Pintard L.
RNAi-Based Suppressor Screens Reveal Genetic Interactions Between the CRL2LRR-1 E3-Ligase and the DNA Replication Machinery in Caenorhabditis elegans.
G3 (Bethesda) 2016 6(10) 3431-3442 
[ PubMed ID = 27543292 ] [ RRC reference ]

Burger J, Merlet J, Tavernier N, Richaudeau B, Arnold A, Ciosk R, Bowerman B, Pintard L.
CRL2(LRR-1) E3-ligase regulates proliferation and progression through meiosis in the Caenorhabditis elegans germline.
PLoS Genet 2013 9(3) e1003375 
[ PubMed ID = 23555289 ] [ RRC reference ]

Merlet J, Burger J, Tavernier N, Richaudeau B, Gomes JE, Pintard L.
The CRL2LRR-1 ubiquitin ligase regulates cell cycle progression during C. elegans development.
Development 2010 137(22) 3857-66 
[ PubMed ID = 20978077 ] [ RRC reference ]