分離済み変異体

tm3526

Allele Nametm3526
BalanceNot Required
OutCrossNot Accepted
Sequence NameY51H4A.12
Gene Nameset-26
Worm BaseAllele Name tm3526
Gene Name set-26
Sequence Y51H4A.12
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. S.S. Lee: deletion confirmed.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 179494/179495-179851/179852 (357 bp deletion)
ChromosomeIV
Putative gene structurecomplement(join(175289..175332, 175464..175728, 176384..177177, 177711..177984, 178467..180302, 181241..182147, 183042..183382, 183470..183840, 183892..183997))
Map position15.14
Balancer
Map position of balancer
Sequence of primersExtFwd:AAGACGAGACCCTGGCAATG,IntFwd:TCGAATCGAAACCACGCCAG,ExtRev:CCGCCGAACTTCCTCCTCAA,IntRev:AAGCCTCCGACGCTCCTCAT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Carvalho CA, Abu-Shach UB, Raju A, Vershinin Z, Levy D, Boxem M, Broday L.
SUMO-mediated regulation of H3K4me3 reader SET-26 controls germline development in C. elegans.
PLoS Biol 2025 23(1) e3002980 
[ PubMed ID = 39761316 ] [ RRC reference ]

Mazzetto M, Gonzalez LE, Sanchez N, Reinke V.
Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis.
Genome Res 2024 34(1) 57-69 
[ PubMed ID = 38164610 ] [ RRC reference ]

Kalinava N, Ni JZ, Peterman K, Chen E, Gu SG.
Decoupling the downstream effects of germline nuclear RNAi reveals that H3K9me3 is dispensable for heritable RNAi and the maintenance of endogenous siRNA-mediated transcriptional silencing in Caenorhabditis elegans.
Epigenetics Chromatin 2017 10 6 
[ PubMed ID = 28228846 ] [ RRC reference ]

Greer EL, Beese-Sims SE, Brookes E, Spadafora R, Zhu Y, Rothbart SB, Aristizábal-Corrales D, Chen S, Badeaux AI, Jin Q, Wang W, Strahl BD, Colaiácovo MP, Shi Y.
A histone methylation network regulates transgenerational epigenetic memory in C. elegans.
Cell Rep 2014 7(1) 113-26 
[ PubMed ID = 24685137 ] [ RRC reference ]