分離済み変異体

tm3525

Allele Nametm3525
BalanceNot Required
OutCrossNot Accepted
Sequence NameT28F2.4
Gene NameT28F2.4
Worm BaseAllele Name tm3525
Gene Name T28F2.4
Sequence T28F2.4
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 7531/7532-7960/7961 (429 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(4570..4940, 5619..6315, 6751..6964, 7013..7616, 8699..8956, 9658..9760))
Map position-3.11
Balancer
Map position of balancer
Sequence of primersExtRev:GCGAAGCGTCCCCTGACAAA,IntFwd:CTGCTTAACAATTTGCGGGT,ExtFwd:GATCGCTAGTGCTGTGTTAT,IntRev:CGTCCCCTGACAAAAATGTT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Peng K, Zhao G, Zhao H, Noda NN, Zhang H.
The autophagy protein ATG-9 regulates lysosome function and integrity.
J Cell Biol 2025 224(6)  
[ PubMed ID = 40202485 ] [ RRC reference ]

Zheng C, Karimzadegan S, Chiang V, Chalfie M.
Histone methylation restrains the expression of subtype-specific genes during terminal neuronal differentiation in Caenorhabditis elegans.
PLoS Genet 2013 9(12) e1004017 
[ PubMed ID = 24348272 ] [ RRC reference ]

Kirienko NV, Fay DS.
SLR-2 and JMJC-1 regulate an evolutionarily conserved stress-response network.
EMBO J 2010 29(4) 727-39 
[ PubMed ID = 20057358 ] [ RRC reference ]