分離済み変異体

tm352

Allele Nametm352
BalanceNot Required
OutCrossNot Accepted
Sequence NameC09D8.1
Gene Nameptp-3
Worm BaseAllele Name tm352
Gene Name ptp-3
Sequence C09D8.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. C. Bargmann & Dr. K. Shen: HSN presynaptic vesicle localization normal. Dr. A. Chisholm & Dr. Y. Jin: J. Neurosci. 25, 7517-7528 (2005).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 16278/16279-16784/16785 (506 bp deletion)
ChromosomeII
Putative gene structurejoin(7765..8062, 8412..8553, 8599..8839, 9244..9457, 15494..15628, 16021..16161, 16225..16348, 16612..16696, 16744..16989, 17249..17390, 17440..17647, 17712..17782, 17904..18263, 26122..26171, 26372..26636, 27251..27463, 27537..27679, 28391..28501, 31225..31357, Z49938.1:6101..6186, Z49938.1:6366..6542, Z49938.1:6660..7175, Z49938.1:7239..7514, Z49938.1:8531..8629, Z49938.1:8718..10336, Z49938.1:10390..10642, Z49938.1:10723..10968, Z49938.1:11022..11132)
Map position3.14
Balancer
Map position of balancer
Sequence of primersExtFwd:CGAGCACAGTTCAGACGGGT,IntFwd:CGGGTTTGGTTACGGATAAA,IntRev:CGGTAGAAGATCGGATAGAA,ExtRev:TCTCGTAGGATGAGTACGGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Caylor RC, Jin Y, Ackley BD.
The Caenorhabditis elegans voltage-gated calcium channel subunits UNC-2 and UNC-36 and the calcium-dependent kinase UNC-43/CaMKII regulate neuromuscular junction morphology.
Neural Dev 2013 8 10 
[ PubMed ID = 23663262 ] [ RRC reference ]

Ackley BD, Harrington RJ, Hudson ML, Williams L, Kenyon CJ, Chisholm AD, Jin Y.
The two isoforms of the Caenorhabditis elegans leukocyte-common antigen related receptor tyrosine phosphatase PTP-3 function independently in axon guidance and synapse formation.
J Neurosci 2005 25(33) 7517-28 
[ PubMed ID = 16107639 ] [ RRC reference ]