| Allele Name | tm3516 |
| Balance | Completed |
| OutCross | Not Accepted |
| Sequence Name | B0205.6 |
| Gene Name | B0205.6 |
| Worm Base | Allele Name |
tm3516
(x1) |
| Gene Name |
B0205.6
|
| Sequence |
B0205.6
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| lethal or sterile. |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 31989/31990-32497/32498 (508 bp deletion) |
| Chromosome | I |
| Putative gene structure | join(30775..30843, 31349..31486, 31531..31650, 31823..31921, 31967..32060, 32213..32347, 32398..32553, 33014..33154, 33464..33630, 33681..33800) |
| Map position | 5.07 |
| Balancer | hT2 [bli-4(e937) let-? qIs48] |
| Map position of balancer | |
| Sequence of primers | ExtFwd:AGTCGACGCAATGCTTCCCT,IntFwd:ACGCAATGCTTCCCTATATG,ExtRev:ACCATACCCATCTCCTTATC,IntRev:GTCCAATGCACAATGGAGCA |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Ast T, Meisel JD, Patra S, Wang H, Grange RMH, Kim SH, Calvo SE, Orefice LL, Nagashima F, Ichinose F, Zapol WM, Ruvkun G, Barondeau DP, Mootha VK. Hypoxia Rescues Frataxin Loss by Restoring Iron Sulfur Cluster Biogenesis. Cell 2019 177(6) 1507-1521.e16
[ PubMed ID = 31031004 ]
[ RRC reference ]
|
C. elegans Deletion Mutant Consortium. large-scale screening for targeted knockouts in the Caenorhabditis elegans genome. G3 (Bethesda) 2012 2(11) 1415-25
[ PubMed ID = 23173093 ]
[ RRC reference ]
|
|