分離済み変異体

tm351

Allele Nametm351
BalanceNot Required
OutCrossNot Accepted
Sequence NameC05D2.4
Gene Namebas-1
Worm BaseAllele Name tm351
Gene Name bas-1
Sequence C05D2.4
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 14928/14929-15739/15740 (811 bp deletion)
ChromosomeIII
Putative gene structurejoin(14756..14878, 15018..15485, 15851..16060, 16107..16460, 16507..16605, 16675..16779, 16885..17070)
Map position-1.47
Balancer
Map position of balancer
Sequence of primersExtRev:TTGCGTTACAGAGCTTCTCA,IntRev:ATCCGCGTTGGTGCTCTGAA,IntFwd:AGGGTAAGAAGATGCTGGAT,ExtFwd:TCCCAAAAATTGCGGACTGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Li G, Wu Y, Huang X, Du M, Tang H.
A gut-brain-gut axis orchestrates host responses counteracting microbiome-induced iron insufficiency.
EMBO J 2025 44(24) 7590-7619 
[ PubMed ID = 41184590 ] [ RRC reference ]

Hernandez-Lima MA, Seo B, Urban ND, Truttmann MC.
Modulation of C. elegans behavior, fitness, and lifespan by AWB/ASH-dependent death perception.
Curr Biol 2025 35(9) 2128-2138.e6 
[ PubMed ID = 40250434 ] [ RRC reference ]

Hernandez-Lima MA, Seo B, Urban ND, Truttmann MC.
C. elegans behavior, fitness, and lifespan, are modulated by AWB/ASH-dependent death perception.
bioRxiv 2024   
[ PubMed ID = 39416137 ] [ RRC reference ]

Levi-Ferber M, Shalash R, Le-Thomas A, Salzberg Y, Shurgi M, Benichou JI, Ashkenazi A, Henis-Korenblit S.
Neuronal regulated ire-1-dependent mRNA decay controls germline differentiation in Caenorhabditis elegans.
Elife 2021 10  
[ PubMed ID = 34477553 ] [ RRC reference ]

Kow RL, Sikkema C, Wheeler JM, Wilkinson CW, Kraemer BC.
DOPA Decarboxylase Modulates Tau Toxicity.
Biol Psychiatry 2018 83(5) 438-446 
[ PubMed ID = 28751068 ] [ RRC reference ]

Masoudi N, Ibanez-Cruceyra P, Offenburger SL, Holmes A, Gartner A.
Tetraspanin (TSP-17) protects dopaminergic neurons against 6-OHDA-induced neurodegeneration in C. elegans.
PLoS Genet 2014 10(12) e1004767 
[ PubMed ID = 25474638 ] [ RRC reference ]

Gruner M, Nelson D, Winbush A, Hintz R, Ryu L, Chung SH, Kim K, Gabel CV, van der Linden AM.
Feeding state, insulin and NPR-1 modulate chemoreceptor gene expression via integration of sensory and circuit inputs.
PLoS Genet 2014 10(10) e1004707 
[ PubMed ID = 25357003 ] [ RRC reference ]

Barros AG, Bridi JC, de Souza BR, de Castro Júnior C, de Lima Torres KC, Malard L, Jorio A, de Miranda DM, Ashrafi K, Romano-Silva MA.
Dopamine signaling regulates fat content through β-oxidation in Caenorhabditis elegans.
PLoS One 2014 9(1) e85874 
[ PubMed ID = 24465759 ] [ RRC reference ]

Matsuura T, Miura H, Nishino A.
Inhibition of gustatory plasticity due to acute nicotine exposure in the nematode Caenorhabditis elegans.
Neurosci Res 2013 77(3) 155-61 
[ PubMed ID = 24025430 ] [ RRC reference ]

Wang Y, Tang L, Feng X, Du W, Liu BF.
Ethanol interferes with gustatory plasticity in Caenorhabditis elegans.
Neurosci Res 2011 71(4) 341-7 
[ PubMed ID = 21889959 ] [ RRC reference ]

Karmacharya R, Lynn SK, Demarco S, Ortiz A, Wang X, Lundy MY, Xie Z, Cohen BM, Miller GM, Buttner EA.
Behavioral effects of clozapine: involvement of trace amine pathways in C. elegans and M. musculus.
Brain Res 2011 1393 91-9 
[ PubMed ID = 21529784 ] [ RRC reference ]

Hukema RK, Rademakers S, Jansen G.
Gustatory plasticity in C. elegans involves integration of negative cues and NaCl taste mediated by serotonin, dopamine, and glutamate.
Learn Mem 2008 15(11) 829-36 
[ PubMed ID = 18984564 ] [ RRC reference ]

Hare EE, Loer CM.
Function and evolution of the serotonin-synthetic bas-1 gene and other aromatic amino acid decarboxylase genes in Caenorhabditis.
BMC Evol Biol 2004 4 24 
[ PubMed ID = 15287963 ] [ RRC reference ]