| Allele Name | tm3505 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | Y51H4A.12 |
| Gene Name | set-26 |
| Worm Base | Allele Name |
tm3505
|
| Gene Name |
set-26
|
| Sequence |
Y51H4A.12
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable. Dr. S.S. Lee: deletion confirmed. |
|
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 179760/179761-180143/180144 (383 bp deletion) |
| Chromosome | IV |
| Putative gene structure | complement(join(175289..175332, 175464..175728, 176384..177177, 177711..177984, 178467..180302, 181241..182147, 183042..183382, 183470..183840, 183892..183997)) |
| Map position | 15.14 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | IntRev:AAGCCTCCGACGCTCCTCAT,ExtRev:CCGCCGAACTTCCTCCTCAA,IntFwd:TCGAATCGAAACCACGCCAG,ExtFwd:AAGACGAGACCCTGGCAATG |
| Distributed lab | |
| Depositor | Dr. S. Mitani |
| References |
Please submit your publication
Carvalho CA, Abu-Shach UB, Raju A, Vershinin Z, Levy D, Boxem M, Broday L.
SUMO-mediated regulation of H3K4me3 reader SET-26 controls germline development in C. elegans.
PLoS Biol 2025 23(1) e3002980
[ PubMed ID = 39761316 ]
[ RRC reference ]
|
Mazzetto M, Gonzalez LE, Sanchez N, Reinke V.
Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis.
Genome Res 2024 34(1) 57-69
[ PubMed ID = 38164610 ]
[ RRC reference ]
|
Ni Z, Ebata A, Alipanahiramandi E, Lee SS.
Two SET domain containing genes link epigenetic changes and aging in Caenorhabditis elegans.
Aging Cell 2012 11(2) 315-25
[ PubMed ID = 22212395 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.