分離済み変異体

tm3489

Allele Nametm3489
BalanceCompleted
OutCrossNot Accepted
Sequence NameC32D5.9
Gene Namelgg-1
Worm BaseAllele Name tm3489 (x1)
Gene Name lgg-1
Sequence C32D5.9
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile. Dr. K. Sato: Science 334, 1141 (2011)
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 35389/35390-35564/35565 (175 bp deletion)
ChromosomeII
Putative gene structurecomplement(join(35252..35335, 35388..35675))
Map position-0.38
BalancermIn1,mIn1 [e128 mIs14]
Map position of balancer
Sequence of primersIntRev:GGTCAATCTCTCAAAACCCA,ExtFwd:CGCTGGCCGAAAATAACGAT,ExtRev:GCCTTACTAGTACTCGTCGT,IntFwd:TGGGAGGGGAGAAGAGCAAC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Kelley LH, Houlihan AS, Yongblah KE, Aljiboury AA, Davis SL, Maine EM.
Poly(U) polymerase activity promotes establishment of primordial germ cells and limits somatic PGL granules in the Caenorhabditis elegans embryo.
Dev Biol 2026 529 241-253 
[ PubMed ID = 41109472 ] [ RRC reference ]

Prusty BK, Hollmann C, Park EC, Liu Z, Nourollahi F, Nikolayshvili G, Dietz J, Bašēns E, Vora M, Waghmare T, Li T, Imdahl F, Rongo C.
Drug-induced metabolic remodeling of immune cell repertoire generates an effective broad-range antimicrobial effect.
Res Sq 2025   
[ PubMed ID = 40766249 ] [ RRC reference ]

Wang S, Xue D.
Asymmetric partitioning of persistent paternal mitochondria during cell divisions safeguards embryo development and mitochondrial inheritance.
Dev Cell 2025   
[ PubMed ID = 39904343 ] [ RRC reference ]

Kolli S, Kline CJ, Rad KM, Wehman AM.
Phagolysosomes break down the membrane of a non-apoptotic corpse independent of macroautophagy.
bioRxiv 2024   
[ PubMed ID = 38948720 ] [ RRC reference ]

Mazzetto M, Gonzalez LE, Sanchez N, Reinke V.
Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis.
Genome Res 2024 34(1) 57-69 
[ PubMed ID = 38164610 ] [ RRC reference ]

Kolli S, Kline CJ, Rad KM, Wehman AM.
Phagolysosomes break down the membrane of a non-apoptotic corpse independent of macroautophagy.
PLoS One 2024 19(11) e0306435 
[ PubMed ID = 39570954 ] [ RRC reference ]

Leboutet R, Largeau C, Müller L, Prigent M, Quinet G, Rodriguez MS, Cuif MH, Hoppe T, Culetto E, Lefebvre C, Legouis R.
LGG-1/GABARAP lipidation is not required for autophagy and development in Caenorhabditis elegans.
Elife 2023 12  
[ PubMed ID = 37395461 ] [ RRC reference ]

Peña-Ramos O, Chiao L, Liu X, Yu X, Yao T, He H, Zhou Z.
Autophagosomes fuse to phagosomes and facilitate the degradation of apoptotic cells in Caenorhabditis elegans.
Elife 2022 11  
[ PubMed ID = 34982028 ] [ RRC reference ]

Rubio-Peña K, Al Rawi S, Husson F, Lam F, Merlet J, Galy V.
Mitophagy of polarized sperm-derived mitochondria after fertilization.
iScience 2021 24(1) 102029 
[ PubMed ID = 33506190 ] [ RRC reference ]

Ko SH, Gonzalez G, Liu Z, Chen L.
Axon Injury-Induced Autophagy Activation Is Impaired in a C. elegans Model of Tauopathy.
Int J Mol Sci 2020 21(22)  
[ PubMed ID = 33202845 ] [ RRC reference ]

Palmisano NJ, Meléndez A.
Autophagy in C. elegans development.
Dev Biol 2019 447(1) 103-125 
[ PubMed ID = 29709599 ] [ RRC reference ]

Jenzer C, Simionato E, Largeau C, Scarcelli V, Lefebvre C, Legouis R.
Autophagy mediates phosphatidylserine exposure and phagosome degradation during apoptosis through specific functions of GABARAP/LGG-1 and LC3/LGG-2.
Autophagy 2019 15(2) 228-241 
[ PubMed ID = 30160610 ] [ RRC reference ]

Chen Y, Scarcelli V, Legouis R.
Approaches for Studying Autophagy in Caenorhabditis elegans.
Cells 2017 6(3)  
[ PubMed ID = 28867808 ] [ RRC reference ]

Chang JT, Kumsta C, Hellman AB, Adams LM, Hansen M.
Spatiotemporal regulation of autophagy during Caenorhabditis elegans aging.
Elife 2017 6  
[ PubMed ID = 28675140 ] [ RRC reference ]

Fazeli G, Trinkwalder M, Irmisch L, Wehman AM.
C. elegans midbodies are released, phagocytosed and undergo LC3-dependent degradation independent of macroautophagy.
J Cell Sci. 2016 129(20) 3721-3731. 
[ PubMed ID = 27562069 ] [ RRC reference ]

Palmisano NJ, Meléndez A.
Detection of Autophagy in Caenorhabditis elegans.
Cold Spring Harb Protoc 2016 2016(2) pdb.top070466 
[ PubMed ID = 26832690 ] [ RRC reference ]

Djeddi A, Al Rawi S, Deuve JL, Perrois C, Liu YY, Russeau M, Sachse M, Galy V.
Sperm-inherited organelle clearance in C. elegans relies on LC3-dependent autophagosome targeting to the pericentrosomal area.
Development 2015 142(9) 1705-16 
[ PubMed ID = 25922527 ] [ RRC reference ]

Jenzer C, Simionato E, Legouis R.
Tools and methods to analyze autophagy in C. elegans.
Methods 2015 75 162-71 
[ PubMed ID = 25484340 ] [ RRC reference ]

Jenzer C, Manil-Ségalen M, Lefebvre C, Largeau C, Glatigny A, Legouis R.
Human GABARAP can restore autophagosome biogenesis in a C. elegans lgg-1 mutant.
Autophagy 2014 10(10) 1868-72 
[ PubMed ID = 25126728 ] [ RRC reference ]

Manil-Ségalen M, Lefebvre C, Jenzer C, Trichet M, Boulogne C, Satiat-Jeunemaitre B, Legouis R.
The C. elegans LC3 acts downstream of GABARAP to degrade autophagosomes by interacting with the HOPS subunit VPS39.
Dev Cell 2014 28(1) 43-55 
[ PubMed ID = 24374177 ] [ RRC reference ]