分離済み変異体

tm3489

Allele Name

tm3489

Balance

Completed

OutCross

Not Accepted

Sequence Name

C32D5.9

Gene Name

lgg-1

Worm Base

Allele Name

tm3489 (x1)

Gene Name

lgg-1

Sequence

C32D5.9

Phenotype

lethal or sterile. Dr. K. Sato: Science 334, 1141 (2011)

Mutation site

35389/35390-35564/35565 (175 bp deletion)

Chromosome

Putative gene structure

complement(join(35252..35335, 35388..35675))

Map position

-0.38

Balancer

mIn1,mIn1 [e128 mIs14]

Map position of balancer

Sequence of primers

IntRev:GGTCAATCTCTCAAAACCCA,ExtFwd:CGCTGGCCGAAAATAACGAT,ExtRev:GCCTTACTAGTACTCGTCGT,IntFwd:TGGGAGGGGAGAAGAGCAAC

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Wang S, Xue D.
Asymmetric partitioning of persistent paternal mitochondria during cell divisions safeguards embryo development and mitochondrial inheritance.
Dev Cell 2025
[ PubMed ID = 39904343 ] [ RRC reference ]

Kolli S, Kline CJ, Rad KM, Wehman AM.
Phagolysosomes break down the membrane of a non-apoptotic corpse independent of macroautophagy.
bioRxiv 2024
[ PubMed ID = 38948720 ] [ RRC reference ]

Mazzetto M, Gonzalez LE, Sanchez N, Reinke V.
Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis.
Genome Res 2024 34(1) 57-69
[ PubMed ID = 38164610 ] [ RRC reference ]

Kolli S, Kline CJ, Rad KM, Wehman AM.
Phagolysosomes break down the membrane of a non-apoptotic corpse independent of macroautophagy.
PLoS One 2024 19(11) e0306435
[ PubMed ID = 39570954 ] [ RRC reference ]

Leboutet R, Largeau C, Müller L, Prigent M, Quinet G, Rodriguez MS, Cuif MH, Hoppe T, Culetto E, Lefebvre C, Legouis R.
LGG-1/GABARAP lipidation is not required for autophagy and development in Caenorhabditis elegans.
Elife 2023 12
[ PubMed ID = 37395461 ] [ RRC reference ]

Peña-Ramos O, Chiao L, Liu X, Yu X, Yao T, He H, Zhou Z.
Autophagosomes fuse to phagosomes and facilitate the degradation of apoptotic cells in Caenorhabditis elegans.
Elife 2022 11
[ PubMed ID = 34982028 ] [ RRC reference ]

Rubio-Peña K, Al Rawi S, Husson F, Lam F, Merlet J, Galy V.
Mitophagy of polarized sperm-derived mitochondria after fertilization.
iScience 2021 24(1) 102029
[ PubMed ID = 33506190 ] [ RRC reference ]

Ko SH, Gonzalez G, Liu Z, Chen L.
Axon Injury-Induced Autophagy Activation Is Impaired in a C. elegans Model of Tauopathy.
Int J Mol Sci 2020 21(22)
[ PubMed ID = 33202845 ] [ RRC reference ]

Palmisano NJ, Meléndez A.
Autophagy in C. elegans development.
Dev Biol 2019 447(1) 103-125
[ PubMed ID = 29709599 ] [ RRC reference ]

Jenzer C, Simionato E, Largeau C, Scarcelli V, Lefebvre C, Legouis R.
Autophagy mediates phosphatidylserine exposure and phagosome degradation during apoptosis through specific functions of GABARAP/LGG-1 and LC3/LGG-2.
Autophagy 2019 15(2) 228-241
[ PubMed ID = 30160610 ] [ RRC reference ]

Chen Y, Scarcelli V, Legouis R.
Approaches for Studying Autophagy in Caenorhabditis elegans.
Cells 2017 6(3)
[ PubMed ID = 28867808 ] [ RRC reference ]

Chang JT, Kumsta C, Hellman AB, Adams LM, Hansen M.
Spatiotemporal regulation of autophagy during Caenorhabditis elegans aging.
Elife 2017 6
[ PubMed ID = 28675140 ] [ RRC reference ]

Fazeli G, Trinkwalder M, Irmisch L, Wehman AM.
C. elegans midbodies are released, phagocytosed and undergo LC3-dependent degradation independent of macroautophagy.
J Cell Sci. 2016 129(20) 3721-3731.
[ PubMed ID = 27562069 ] [ RRC reference ]

Palmisano NJ, Meléndez A.
Detection of Autophagy in Caenorhabditis elegans.
Cold Spring Harb Protoc 2016 2016(2) pdb.top070466
[ PubMed ID = 26832690 ] [ RRC reference ]

Djeddi A, Al Rawi S, Deuve JL, Perrois C, Liu YY, Russeau M, Sachse M, Galy V.
Sperm-inherited organelle clearance in C. elegans relies on LC3-dependent autophagosome targeting to the pericentrosomal area.
Development 2015 142(9) 1705-16
[ PubMed ID = 25922527 ] [ RRC reference ]

Jenzer C, Simionato E, Legouis R.
Tools and methods to analyze autophagy in C. elegans.
Methods 2015 75 162-71
[ PubMed ID = 25484340 ] [ RRC reference ]

Jenzer C, Manil-Ségalen M, Lefebvre C, Largeau C, Glatigny A, Legouis R.
Human GABARAP can restore autophagosome biogenesis in a C. elegans lgg-1 mutant.
Autophagy 2014 10(10) 1868-72
[ PubMed ID = 25126728 ] [ RRC reference ]

Manil-Ségalen M, Lefebvre C, Jenzer C, Trichet M, Boulogne C, Satiat-Jeunemaitre B, Legouis R.
The C. elegans LC3 acts downstream of GABARAP to degrade autophagosomes by interacting with the HOPS subunit VPS39.
Dev Cell 2014 28(1) 43-55
[ PubMed ID = 24374177 ] [ RRC reference ]

Manil-Ségalen M, Culetto E, Legouis R, Lefebvre C.
Interactions between endosomal maturation and autophagy: analysis of ESCRT machinery during Caenorhabditis elegans development.
Methods Enzymol 2014 534 93-118
[ PubMed ID = 24359950 ] [ RRC reference ]

Al Rawi S, Louvet-Vallée S, Djeddi A, Sachse M, Culetto E, Hajjar C, Boyd L, Legouis R, Galy V.
Postfertilization autophagy of sperm organelles prevents paternal mitochondrial DNA transmission.
Science 2011 334(6059) 1144-7
[ PubMed ID = 22033522 ] [ RRC reference ]