| Allele Name | tm3448 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | T15B7.16 |
| Gene Name | T15B7.16 |
| Worm Base | Allele Name |
tm3448
|
| Gene Name |
T15B7.16
|
| Sequence |
T15B7.16
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable. Dr. C. Bargmann: normal locomotion on food. |
|
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 31303/31304-31928/31929 (625 bp deletion) |
| Chromosome | V |
| Putative gene structure | complement(join(29889..29987, 30035..30134, 30192..30311, 30375..30451, 30984..31379, 31607..31792, 31846..32101, 32279..32352)) |
| Map position | 0.35 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | IntRev:CAATCCGCGTCGATCACATT,ExtRev:ACATCTCCGGGTGCACAATC,IntFwd:TCCGTAAATCGACAGCGATG,ExtFwd:ACGGGCTCGATATCAGATGA |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Zou W, Fan Y, Liu J, Cheng H, Hong H, Al-Sheikh U, Li S, Zhu L, Li R, He L, Tang YQ, Zhao G, Zhang Y, Wang F, Zhan R, Zheng X, Kang L.
Anoctamin-1 is a core component of a mechanosensory anion channel complex in C. elegans.
Nat Commun 2025 16(1) 1680
[ PubMed ID = 39956854 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.