分離済み変異体

tm3433

Allele Nametm3433
BalanceNot Required
OutCrossNot Accepted
Sequence NameC27A7.4
Gene Nameche-11
Worm BaseAllele Name tm3433
Gene Name che-11
Sequence C27A7.4
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 19399/19400-19939/19940 (540 bp deletion)
ChromosomeV
Putative gene structurecomplement(join(17635..17972, 18027..18189, 18234..18446, 18489..18610, 18658..19472, 19520..19900, 19948..20056, 20103..20316, 20425..20706, 20752..20869, 20919..21184, 21231..21496, 22134..22455, 23059..23251, 23301..23422, 23470..23555, 23607..23679))
Map position3.67
Balancer
Map position of balancer
Sequence of primersExtFwd:CCAGGAAGATCTTCGTAGTA,IntFwd:CCACCCGCCATCAAGCATAA,ExtRev:GGTAGTCACTTATGACGTAC,IntRev:TGGATGGCAGTTGCTACTAC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Turan MG, Kantarci H, Cevik S, Kaplan OI.
ARL13B regulates juxtaposed cilia-cilia elongation in BBSome dependent manner in Caenorhabditis elegans.
iScience 2025 28(2) 111791 
[ PubMed ID = 39925426 ] [ RRC reference ]

Cevik S, Peng X, Beyer T, Pir MS, Yenisert F, Woerz F, Hoffmann F, Altunkaynak B, Pir B, Boldt K, Karaman A, Cakiroglu M, Oner SS, Cao Y, Ueffing M, Kaplan OI.
WDR31 displays functional redundancy with GTPase-activating proteins (GAPs) ELMOD and RP2 in regulating IFT complex and recruiting the BBSome to cilium.
Life Sci Alliance 2023 6(8)  
[ PubMed ID = 37208194 ] [ RRC reference ]

Reed R, Park K, Waddell B, Timbers TA, Li C, Baxi K, Giacomin RM, Leroux MR, Carvalho CE.
The Caenorhabditis elegans Shugoshin regulates TAC-1 in cilia.
Sci Rep 2023 13(1) 9410 
[ PubMed ID = 37296204 ] [ RRC reference ]

Kaplan OI.
RPI-1 (human DCDC2) displays functional redundancy with Nephronophthisis 4 in regulating cilia biogenesis in C. elegans.
Turk J Biol 2023 47(1) 74-83 
[ PubMed ID = 37529113 ] [ RRC reference ]

Park K, Li C, Tsiropoulou S, Gonçalves J, Kondratev C, Pelletier L, Blacque OE, Leroux MR.
CDKL kinase regulates the length of the ciliary proximal segment.
Curr Biol 2021 31(11) 2359-2373.e7 
[ PubMed ID = 33857430 ] [ RRC reference ]

Cevik S, Kaplan OI.
Subcellular localization of the voltage-gated K+ channel EGL-36 , a member of the KV3 subfamily, in the ciliated sensory neurons in C. elegans.
MicroPubl Biol 2021 2021  
[ PubMed ID = 33688626 ] [ RRC reference ]

Serwas D, Su TY, Roessler M, Wang S, Dammermann A.
Centrioles initiate cilia assembly but are dispensable for maturation and maintenance in C. elegans.
J Cell Biol 2017 216(6) 1659-1671 
[ PubMed ID = 28411189 ] [ RRC reference ]

Prevo B, Mangeol P, Oswald F, Scholey JM, Peterman EJ.
Functional differentiation of cooperating kinesin-2 motors orchestrates cargo import and transport in C. elegans cilia.
Nat Cell Biol 2015 17(12) 1536-45 
[ PubMed ID = 26523365 ] [ RRC reference ]