分離済み変異体

tm3425

Allele Nametm3425
BalanceNot Required
OutCrossNot Accepted
Sequence NameC56C10.12
Gene Nameepg-5
Worm BaseAllele Name tm3425
Gene Name epg-5
Sequence C56C10.12
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. S. McIntire: sluggish locomotion. Dr. H. Sawa: not Psa, vacuoles in the gut.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 33713/33714-34452/34453 (739 bp deletion)
ChromosomeII
Putative gene structurecomplement(join(29155..29274, 29369..29455, 29504..29960, 30356..31552, 31600..32324, 32368..32492, 32540..32832, 32879..32955, 33005..33063, 33119..33506, 33558..33691, 33742..34345, 34392..34649, 34696..34795, 34845..34906, 34957..35070))
Map position-0.08
Balancer
Map position of balancer
Sequence of primersIntRev:TGGCGGAATTGGTTCGTCCA,ExtFwd:CGAACGCTGTGCCTGAAAGA,IntFwd:TCTAGGAGCCAAAGGATAAC,ExtRev:TCGTACTGTACTTGTCGCAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Yuan C, Dong H, Wu C, Liu J, Wang Z, Wang X, Ren H, Wang Z, Lu Q.
EPG-5 regulates TGFB/TGF-β and WNT signalling by modulating retrograde endocytic trafficking.
Autophagy 2025  1-14 
[ PubMed ID = 40152605 ] [ RRC reference ]

Ruan M, Xu F, Li N, Yu J, Teng F, Tang J, Huang C, Zhu H.
Free long-chain fatty acids trigger early postembryonic development in starved Caenorhabditis elegans by suppressing mTORC1.
PLoS Biol 2024 22(10) e3002841 
[ PubMed ID = 39436954 ] [ RRC reference ]

Hu Z, Luo Y, Liu Y, Luo Y, Wang L, Gou S, Peng Y, Wei R, Jia D, Wang Y, Gao S, Zhang Y.
Partial inhibition of class III PI3K VPS-34 ameliorates motor aging and prolongs health span.
PLoS Biol 2023 21(7) e3002165 
[ PubMed ID = 37432924 ] [ RRC reference ]

Wang F, Dai Y, Zhu X, Chen Q, Zhu H, Zhou B, Tang H, Pang S.
Saturated very long chain fatty acid configures glycosphingolipid for lysosome homeostasis in long-lived C. elegans.
Nat Commun 2021 12(1) 5073 
[ PubMed ID = 34417467 ] [ RRC reference ]

Zhang Y, Qi L, Zhang H.
TGFβ-like DAF-7 acts as a systemic signal for autophagy regulation in C. elegans.
J Cell Biol 2019 218(12) 3998-4006 
[ PubMed ID = 31658998 ] [ RRC reference ]

Wang Z, Zhao H, Yuan C, Zhao D, Sun Y, Wang X, Zhang H.
The RBG-1-RBG-2 complex modulates autophagy activity by regulating lysosomal biogenesis and function in C. elegans.
J Cell Sci 2019 132(19)  
[ PubMed ID = 31444285 ] [ RRC reference ]

Min H, Lee YU, Shim YH, Kawasaki I.
Autophagy of germ-granule components, PGL-1 and PGL-3, contributes to DNA damage-induced germ cell apoptosis in C. elegans.
PLoS Genet 2019 15(5) e1008150 
[ PubMed ID = 31125345 ] [ RRC reference ]

Palmisano NJ, Meléndez A.
Autophagy in C. elegans development.
Dev Biol 2019 447(1) 103-125 
[ PubMed ID = 29709599 ] [ RRC reference ]

Chen Y, Scarcelli V, Legouis R.
Approaches for Studying Autophagy in Caenorhabditis elegans.
Cells 2017 6(3)  
[ PubMed ID = 28867808 ] [ RRC reference ]

Stavoe AK, Hill SE, Hall DH, Colón-Ramos DA.
KIF1A/UNC-104 Transports ATG-9 to Regulate Neurodevelopment and Autophagy at Synapses.
Dev Cell 2016 38(2) 171-85 
[ PubMed ID = 27396362 ] [ RRC reference ]

Wu F, Watanabe Y, Guo XY, Qi X, Wang P, Zhao HY, Wang Z, Fujioka Y, Zhang H, Ren JQ, Fang TC, Shen YX, Feng W, Hu JJ, Noda NN, Zhang H.
Structural Basis of the Differential Function of the Two C. elegans Atg8 Homologs, LGG-1 and LGG-2, in Autophagy.
Mol Cell 2015 60(6) 914-29 
[ PubMed ID = 26687600 ] [ RRC reference ]

Guo B, Liang Q, Li L, Hu Z, Wu F, Zhang P, Ma Y, Zhao B, Kovács AL, Zhang Z, Feng D, Chen S, Zhang H.
O-GlcNAc-modification of SNAP-29 regulates autophagosome maturation.
Nat Cell Biol 2014 16(12) 1215-26 
[ PubMed ID = 25419848 ] [ RRC reference ]

Cheng S, Wu Y, Lu Q, Yan J, Zhang H, Wang X.
Autophagy genes coordinate with the class II PI/PtdIns 3-kinase PIKI-1 to regulate apoptotic cell clearance in C. elegans.
Autophagy 2013 9(12) 2022-32 
[ PubMed ID = 24165672 ] [ RRC reference ]

Wang H, Lu Q, Cheng S, Wang X, Zhang H.
Autophagy activity contributes to programmed cell death in Caenorhabditis elegans.
Autophagy 2013 9(12) 1975-82 
[ PubMed ID = 24185352 ] [ RRC reference ]

Zhang P, Zhang H.
Autophagy modulates miRNA-mediated gene silencing and selectively degrades AIN-1/GW182 in C. elegans.
EMBO Rep 2013 14(6) 568-76 
[ PubMed ID = 23619095 ] [ RRC reference ]

Lin L, Yang P, Huang X, Zhang H, Lu Q, Zhang H.
The scaffold protein EPG-7 links cargo-receptor complexes with the autophagic assembly machinery.
J Cell Biol 2013 201(1) 113-29 
[ PubMed ID = 23530068 ] [ RRC reference ]

Huang S, Jia K, Wang Y, Zhou Z, Levine B.
Autophagy genes function in apoptotic cell corpse clearance during C. elegans embryonic development.
Autophagy 2013 9(2) 138-49 
[ PubMed ID = 23108454 ] [ RRC reference ]

Li W, Zou W, Yang Y, Chai Y, Chen B, Cheng S, Tian D, Wang X, Vale RD, Ou G.
Autophagy genes function sequentially to promote apoptotic cell corpse degradation in the engulfing cell.
J Cell Biol 2012 197(1) 27-35 
[ PubMed ID = 22451698 ] [ RRC reference ]

Sun T, Wang X, Lu Q, Ren H, Zhang H.
CUP-5, the C. elegans ortholog of the mammalian lysosomal channel protein MLN1/TRPML1, is required for proteolytic degradation in autolysosomes.
Autophagy 2011 7(11) 1308-15 
[ PubMed ID = 21997367 ] [ RRC reference ]

Lu Q, Yang P, Huang X, Hu W, Guo B, Wu F, Lin L, Kovács AL, Yu L, Zhang H.
The WD40 repeat PtdIns(3)P-binding protein EPG-6 regulates progression of omegasomes to autophagosomes.
Dev Cell 2011 21(2) 343-57 
[ PubMed ID = 21802374 ] [ RRC reference ]