分離済み変異体

tm3411

Allele Nametm3411
BalanceCompleted
OutCrossNot Accepted
Sequence NameT19E7.2
Gene Nameskn-1
Worm BaseAllele Name tm3411 (x1)
Gene Name skn-1
Sequence T19E7.2
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 274/275-586/587 (312 bp deletion)
ChromosomeIV
Putative gene structurecomplement(join(36..112, 165..532, 686..944, 1621..1773, 1827..2148, 3455..3877)), complement(join(36..112, 165..532, 686..944, 1139..1367))
Map position2.02
BalancernT1 [qIs51]
Map position of balancer
Sequence of primersExtFwd:AGGGCTTCTCAGATGTAATG,IntFwd:GGGACATCTTGTCGTGACGA,ExtRev:CATATCTTGGAATGGCAGAG,IntRev:GTTAACCTAGAAGCGGCTTA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Cornwell AB, Zhang Y, Thondamal M, Johnson DW, Thakar J, Samuelson AV.
The C. elegans Myc-family of transcription factors coordinate a dynamic adaptive response to dietary restriction.
Geroscience 2024 46(5) 4827-4854 
[ PubMed ID = 38878153 ] [ RRC reference ]

Cornwell A, Zhang Y, Thondamal M, Johnson DW, Thakar J, Samuelson AV.
The C. elegans Myc-family of transcription factors coordinate a dynamic adaptive response to dietary restriction.
bioRxiv 2023   
[ PubMed ID = 38045350 ] [ RRC reference ]

Yang R, Kang Y, Duan J, Zou C, Wu Q.
The p38 MAPK/PMK-1 Pathway Is Required for Resistance to Nocardia farcinica Infection in Caenorhabditis elegance.
Pathogens 2022 11(10)  
[ PubMed ID = 36297128 ] [ RRC reference ]

Joshi KK, Matlack TL, Rongo C.
Dopamine signaling promotes the xenobiotic stress response and protein homeostasis.
EMBO J 2016 35(17) 1885-901 
[ PubMed ID = 27261197 ] [ RRC reference ]

Dresen A, Finkbeiner S, Dottermusch M, Beume JS, Li Y, Walz G, Neumann-Haefelin E.
Caenorhabditis elegans OSM-11 signaling regulates SKN-1/Nrf during embryonic development and adult longevity and stress response.
Dev Biol 2015 400(1) 118-31 
[ PubMed ID = 25637691 ] [ RRC reference ]

Ewald CY, Landis JN, Porter Abate J, Murphy CT, Blackwell TK.
Dauer-independent insulin/IGF-1-signalling implicates collagen remodelling in longevity.
Nature 2015 519(7541) 97-101 
[ PubMed ID = 25517099 ] [ RRC reference ]

Ruf V, Holzem C, Peyman T, Walz G, Blackwell TK, Neumann-Haefelin E.
TORC2 signaling antagonizes SKN-1 to induce C. elegans mesendodermal embryonic development.
Dev Biol 2013 384(2) 214-27 
[ PubMed ID = 23973804 ] [ RRC reference ]

Ghose P, Park EC, Tabakin A, Salazar-Vasquez N, Rongo C.
Anoxia-reoxygenation regulates mitochondrial dynamics through the hypoxia response pathway, SKN-1/Nrf, and stomatin-like protein STL-1/SLP-2.
PLoS Genet 2013 9(12) e1004063 
[ PubMed ID = 24385935 ] [ RRC reference ]