分離済み変異体

tm3410

Allele Nametm3410
BalanceNot Required
OutCrossNot Accepted
Sequence NameY32H12A.5
Gene NameY32H12A.5
Worm BaseAllele Name tm3410 (x1)
Gene Name Y32H12A.5
Sequence Y32H12A.5
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 30927/30928-GAAAAA-31699/31700 (772 bp deletion + 6 bp insertion)
ChromosomeIII
Putative gene structurecomplement(join(29959..30183, 30397..31131, 31540..31907, 32590..32729, 32778..32881, 33414..33503, 33581..33664))
Map position-1.79
BalancerhT2
Map position of balancer
Sequence of primersExtFwd:TGGGAGATCGCGTGATAATG,IntFwd:AGCGGCGAGCACGACAAATG,ExtRev:CCCTCCTTTCACTAAACTAC,IntRev:GGAGATGTCCCATCAACGTC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Horikawa M, Fukuyama M, Antebi A, Mizunuma M.
Regulatory mechanism of cold-inducible diapause in Caenorhabditis elegans.
Nat Commun 2024 15(1) 5793 
[ PubMed ID = 38987256 ] [ RRC reference ]

Mazzetto M, Gonzalez LE, Sanchez N, Reinke V.
Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis.
Genome Res 2024 34(1) 57-69 
[ PubMed ID = 38164610 ] [ RRC reference ]

Chen YL, Ma YC, Tang J, Zhang D, Zhao Q, Liu JJ, Tang HS, Zhang JY, He GH, Zhong CH, Wu YT, Wen HR, Ma LQ, Zou CG.
Physical exercise attenuates age-related muscle atrophy and exhibits anti-ageing effects via the adiponectin receptor 1 signalling.
J Cachexia Sarcopenia Muscle 2023 14(4) 1789-1801 
[ PubMed ID = 37222007 ] [ RRC reference ]

Lee CH, Lee YY, Chang YC, Pon WL, Lee SP, Wali N, Nakazawa T, Honda Y, Shie JJ, Hsueh YP.
A carnivorous mushroom paralyzes and kills nematodes via a volatile ketone.
Sci Adv 2023 9(3) eade4809 
[ PubMed ID = 36652525 ] [ RRC reference ]

Ruiz M, Devkota R, Panagaki D, Bergh PO, Kaper D, Henricsson M, Nik A, Petkevicius K, Höög JL, Bohlooly-Y M, Carlsson P, Borén J, Pilon M.
Sphingosine 1-phosphate mediates adiponectin receptor signaling essential for lipid homeostasis and embryogenesis.
Nat Commun 2022 13(1) 7162 
[ PubMed ID = 36418331 ] [ RRC reference ]

Watterson A, Tatge L, Wajahat N, Arneaud SLB, Solano Fonseca R, Beheshti ST, Metang P, Mihelakis M, Zuurbier KR, Corley CD, Dehghan I, McDonald JG, Douglas PM.
Intracellular lipid surveillance by small G protein geranylgeranylation.
Nature 2022 605(7911) 736-740 
[ PubMed ID = 35585236 ] [ RRC reference ]

Vieira AFC, Xatse MA, Tifeki H, Diot C, Walhout AJM, Olsen CP.
Monomethyl branched-chain fatty acids are critical for Caenorhabitis elegans survival in elevated glucose conditions.
J Biol Chem 2022 298(2) 101444 
[ PubMed ID = 34826420 ] [ RRC reference ]

Devkota R, Kaper D, Bodhicharla R, Henricsson M, Borén J, Pilon M.
A genetic titration of membrane composition in Caenorhabditis elegans reveals its importance for multiple cellular and physiological traits.
Genetics 2021 219(1)  
[ PubMed ID = 34125894 ] [ RRC reference ]

Busayavalasa K, Ruiz M, Devkota R, Ståhlman M, Bodhicharla R, Svensk E, Hermansson NO, Borén J, Pilon M.
Leveraging a gain-of-function allele of Caenorhabditis elegans paqr-1 to elucidate membrane homeostasis by PAQR proteins.
PLoS Genet 2020 16(8) e1008975 
[ PubMed ID = 32750056 ] [ RRC reference ]

Ruiz M, Bodhicharla R, Ståhlman M, Svensk E, Busayavalasa K, Palmgren H, Ruhanen H, Boren J, Pilon M.
Evolutionarily conserved long-chain Acyl-CoA synthetases regulate membrane composition and fluidity.
Elife 2019 8  
[ PubMed ID = 31769755 ] [ RRC reference ]

Lee D, An SWA, Jung Y, Yamaoka Y, Ryu Y, Goh GYS, Beigi A, Yang JS, Jung GY, Ma DK, Ha CM, Taubert S, Lee Y, Lee SV.
MDT-15/MED15 permits longevity at low temperature via enhancing lipidostasis and proteostasis.
PLoS Biol 2019 17(8) e3000415 
[ PubMed ID = 31408455 ] [ RRC reference ]

Chen YL, Tao J, Zhao PJ, Tang W, Xu JP, Zhang KQ, Zou CG.
Adiponectin receptor PAQR-2 signaling senses low temperature to promote C. elegans longevity by regulating autophagy.
Nat Commun 2019 10(1) 2602 
[ PubMed ID = 31197136 ] [ RRC reference ]

Ruiz M, Bodhicharla R, Svensk E, Devkota R, Busayavalasa K, Palmgren H, Ståhlman M, Boren J, Pilon M.
Membrane fluidity is regulated by the C. elegans transmembrane protein FLD-1 and its human homologs TLCD1/2.
Elife 2018 7  
[ PubMed ID = 30509349 ] [ RRC reference ]

Bodhicharla R, Devkota R, Ruiz M, Pilon M.
Membrane Fluidity Is Regulated Cell Nonautonomously by Caenorhabditiselegans PAQR-2 and Its Mammalian Homolog AdipoR2.
Genetics 2018 210(1) 189-201 
[ PubMed ID = 29997234 ] [ RRC reference ]

Kyriakakis E, Charmpilas N, Tavernarakis N.
Differential adiponectin signalling couples ER stress with lipid metabolism to modulate ageing in C. elegans.
Sci Rep 2017 7(1) 5115 
[ PubMed ID = 28698593 ] [ RRC reference ]

Svensk E, Devkota R, Ståhlman M, Ranji P, Rauthan M, Magnusson F, Hammarsten S, Johansson M, Borén J, Pilon M.
Caenorhabditis elegans PAQR-2 and IGLR-2 Protect against Glucose Toxicity by Modulating Membrane Lipid Composition.
PLoS Genet 2016 12(4) e1005982 
[ PubMed ID = 27082444 ] [ RRC reference ]

Svensk E, Biermann J, Hammarsten S, Magnusson F, Pilon M.
Leveraging the withered tail tip phenotype in C. elegans to identify proteins that influence membrane properties.
Worm 2016 5(3) e1206171 
[ PubMed ID = 27695656 ] [ RRC reference ]

Lee D, Jeong DE, Son HG, Yamaoka Y, Kim H, Seo K, Khan AA, Roh TY, Moon DW, Lee Y, Lee SJ.
SREBP and MDT-15 protect C. elegans from glucose-induced accelerated aging by preventing accumulation of saturated fat.
Genes Dev 2015 29(23) 2490-503 
[ PubMed ID = 26637528 ] [ RRC reference ]

Svensk E, Ståhlman M, Andersson CH, Johansson M, Borén J, Pilon M.
PAQR-2 regulates fatty acid desaturation during cold adaptation in C. elegans.
PLoS Genet 2013 9(9) e1003801 
[ PubMed ID = 24068966 ] [ RRC reference ]

Svensson E, Olsen L, Mörck C, Brackmann C, Enejder A, Faergeman NJ, Pilon M.
The adiponectin receptor homologs in C. elegans promote energy utilization and homeostasis.
PLoS One 2011 6(6) e21343 
[ PubMed ID = 21712952 ] [ RRC reference ]