| Allele Name | tm3394 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | R12E2.9 |
| Gene Name | inx-15 |
| Worm Base | Allele Name |
tm3394
|
| Gene Name |
inx-15
|
| Sequence |
R12E2.9
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable. Dr. C.P. Hunter: no growth or fertility defects at 20C. Dr. C-F. Chuang: normal AWC signaling. |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 12762/12763-13220/13221 (458 bp deletion) |
| Chromosome | I |
| Putative gene structure | complement(join(11504..11641, 11688..11966, 12019..12092, 12592..13120, 13389..13517)) |
| Map position | -1.65 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtRev:TTCCTCTTGGCATACCAGAG,IntRev:TACCAGAGACACTCTCCCTC,ExtFwd:CTGGCTAGTTATATCCCCCA,IntFwd:CCCCCAGCTTCAGATTAATC |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Zhang X, Wang Y, Cai Z, Wan Z, Aihemaiti Y, Tu H. A gonadal gap junction INX-14/Notch GLP-1 signaling axis suppresses gut defense through an intestinal lysosome pathway. Front Immunol 2023 14 1249436
[ PubMed ID = 37928537 ]
[ RRC reference ]
|
Jang H, Levy S, Flavell SW, Mende F, Latham R, Zimmer M, Bargmann CI. Dissection of neuronal gap junction circuits that regulate social behavior in Caenorhabditis elegans. Proc Natl Acad Sci U S A 2017 114(7) E1263-E1272
[ PubMed ID = 28143932 ]
[ RRC reference ]
|
Liu P, Chen B, Altun ZF, Gross MJ, Shan A, Schuman B, Hall DH, Wang ZW. Six innexins contribute to electrical coupling of C. elegans body-wall muscle. PLoS One 2013 8(10) e76877
[ PubMed ID = 24130800 ]
[ RRC reference ]
|
|