分離済み変異体

tm3394

Allele Nametm3394
BalanceNot Required
OutCrossNot Accepted
Sequence NameR12E2.9
Gene Nameinx-15
Worm BaseAllele Name tm3394
Gene Name inx-15
Sequence R12E2.9
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. C.P. Hunter: no growth or fertility defects at 20C. Dr. C-F. Chuang: normal AWC signaling.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 12762/12763-13220/13221 (458 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(11504..11641, 11688..11966, 12019..12092, 12592..13120, 13389..13517))
Map position-1.65
Balancer
Map position of balancer
Sequence of primersExtRev:TTCCTCTTGGCATACCAGAG,IntRev:TACCAGAGACACTCTCCCTC,ExtFwd:CTGGCTAGTTATATCCCCCA,IntFwd:CCCCCAGCTTCAGATTAATC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Zhang X, Wang Y, Cai Z, Wan Z, Aihemaiti Y, Tu H.
A gonadal gap junction INX-14/Notch GLP-1 signaling axis suppresses gut defense through an intestinal lysosome pathway.
Front Immunol 2023 14 1249436 
[ PubMed ID = 37928537 ] [ RRC reference ]

Jang H, Levy S, Flavell SW, Mende F, Latham R, Zimmer M, Bargmann CI.
Dissection of neuronal gap junction circuits that regulate social behavior in Caenorhabditis elegans.
Proc Natl Acad Sci U S A 2017 114(7) E1263-E1272 
[ PubMed ID = 28143932 ] [ RRC reference ]

Liu P, Chen B, Altun ZF, Gross MJ, Shan A, Schuman B, Hall DH, Wang ZW.
Six innexins contribute to electrical coupling of C. elegans body-wall muscle.
PLoS One 2013 8(10) e76877 
[ PubMed ID = 24130800 ] [ RRC reference ]