分離済み変異体

tm339

Allele Nametm339
BalanceNot Required
OutCrossNot Accepted
Sequence NameT28B8.2
Gene Nameins-18
Worm BaseAllele Name tm339
Gene Name ins-18
Sequence T28B8.2
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. C. Kenyon: normal life span. Dr. P. Roy: normal muscle arm development. Dr. P.W. Sternberg: normal locomotion. Dr. J. Alcedo: non-Daf-c at 25C.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 17514/17515-AATCGGG-18930/18931 (1416 bp deletion)
ChromosomeI
Putative gene structurejoin(16540..16618, 17961..18057,18517..18620)
Map position2.6
Balancer
Map position of balancer
Sequence of primersExtFwd:GGGAAAGTTCGACACCAATC,ExtRev:TATTGTTACTGCCCATAGGC,IntFwd:CCCTGTGGGAGGAAAAATTT,IntRev:GCCCCATAACAGAAAACTAC
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Subasinghe WTRDW, Miyahara K, Motoyama S, Takeya H.
A novel target for the insulin signaling pathway in glucose-mediated growth regulation.
J Biochem 2026 179(3) 177-184 
[ PubMed ID = 41469326 ] [ RRC reference ]

Le TA, Temmerman L, Roy C.
Nictation behavior in nematodes.
BMC Biol 2025 23(1) 356 
[ PubMed ID = 41350688 ] [ RRC reference ]

Matty MA, Lau HE, Haley JA, Singh A, Chakraborty A, Kono K, Reddy KC, Hansen M, Chalasani SH.
Intestine-to-neuronal signaling alters risk-taking behaviors in food-deprived Caenorhabditis elegans.
PLoS Genet 2022 18(5) e1010178 
[ PubMed ID = 35511794 ] [ RRC reference ]

Matsunaga Y, Matsukawa T, Iwasaki T, Nagata K, Kawano T.
Comparison of physiological functions of antagonistic insulin-like peptides, INS-23 and INS-18, in Caenorhabditis elegans.
Biosci Biotechnol Biochem 2018 82(1) 90-96 
[ PubMed ID = 29303423 ] [ RRC reference ]

Hung WL, Hwang C, Gao S, Liao EH, Chitturi J, Wang Y, Li H, Stigloher C, Bessereau JL, Zhen M.
Attenuation of insulin signalling contributes to FSN-1-mediated regulation of synapse development.
EMBO J 2013 32(12) 1745-60 
[ PubMed ID = 23665919 ] [ RRC reference ]

Matsunaga Y, Gengyo-Ando K, Mitani S, Iwasaki T, Kawano T.
Physiological function, expression pattern, and transcriptional regulation of a Caenorhabditis elegans insulin-like peptide, INS-18.
Biochem Biophys Res Commun 2012 423(3) 478-83 
[ PubMed ID = 22683638 ] [ RRC reference ]

Matsunaga Y, Nakajima K, Gengyo-Ando K, Mitani S, Iwasaki T, Kawano T.
A Caenorhabditis elegans insulin-like peptide, INS-17: its physiological function and expression pattern.
Biosci Biotechnol Biochem 2012 76(11) 2168-72 
[ PubMed ID = 23132577 ] [ RRC reference ]

Narasimhan SD, Yen K, Bansal A, Kwon ES, Padmanabhan S, Tissenbaum HA.
PDP-1 links the TGF-β and IIS pathways to regulate longevity, development, and metabolism.
PLoS Genet 2011 7(4) e1001377 
[ PubMed ID = 21533078 ] [ RRC reference ]

Lee SJ, Murphy CT, Kenyon C.
Glucose shortens the life span of C. elegans by downregulating DAF-16/FOXO activity and aquaporin gene expression.
Cell Metab 2009 10(5) 379-91 
[ PubMed ID = 19883616 ] [ RRC reference ]

Ouellet J, Li S, Roy R.
Notch signalling is required for both dauer maintenance and recovery in C. elegans.
Development 2008 135(15) 2583-92 
[ PubMed ID = 18599512 ] [ RRC reference ]