分離済み変異体

tm339

Allele Name

tm339

Allele Type

通常株

Sequence Name

T28B8.2

Gene Name

ins-18

Worm Base

Allele Name

tm339

Gene Name

ins-18

Sequence

T28B8.2

Phenotype

homozygous viable. Dr. C. Kenyon: normal life span. Dr. P. Roy: normal muscle arm development. Dr. P.W. Sternberg: normal locomotion. Dr. J. Alcedo: non-Daf-c at 25C.

Mutation site

17514/17515-AATCGGG-18930/18931 (1416 bp deletion)

Chromosome

Putative gene structure

join(16540..16618, 17961..18057,18517..18620)

Map position

2.6

Balancer

Map position of balancer

Sequence of primers

ExtFwd:GGGAAAGTTCGACACCAATC,ExtRev:TATTGTTACTGCCCATAGGC,IntFwd:CCCTGTGGGAGGAAAAATTT,IntRev:GCCCCATAACAGAAAACTAC

Distributed lab

Depositor

Dr. S. Mitani

References

Please submit your publication

Matty MA, Lau HE, Haley JA, Singh A, Chakraborty A, Kono K, Reddy KC, Hansen M, Chalasani SH.
Intestine-to-neuronal signaling alters risk-taking behaviors in food-deprived Caenorhabditis elegans.
PLoS Genet 2022 18(5) e1010178
[ PubMed ID = 35511794 ] [ RRC reference ]

Matsunaga Y, Matsukawa T, Iwasaki T, Nagata K, Kawano T.
Comparison of physiological functions of antagonistic insulin-like peptides, INS-23 and INS-18, in Caenorhabditis elegans.
Biosci Biotechnol Biochem 2018 82(1) 90-96
[ PubMed ID = 29303423 ] [ RRC reference ]

Narasimhan SD, Yen K, Bansal A, Kwon ES, Padmanabhan S, Tissenbaum HA.
PDP-1 links the TGF-β and IIS pathways to regulate longevity, development, and metabolism.
PLoS Genet 2011 7(4) e1001377
[ PubMed ID = 21533078 ] [ RRC reference ]

Hung WL, Hwang C, Gao S, Liao EH, Chitturi J, Wang Y, Li H, Stigloher C, Bessereau JL, Zhen M.
Attenuation of insulin signalling contributes to FSN-1-mediated regulation of synapse development.
EMBO J 2013 32(12) 1745-60
[ PubMed ID = 23665919 ] [ RRC reference ]

Matsunaga Y, Nakajima K, Gengyo-Ando K, Mitani S, Iwasaki T, Kawano T.
A Caenorhabditis elegans insulin-like peptide, INS-17: its physiological function and expression pattern.
Biosci Biotechnol Biochem 2012 76(11) 2168-72
[ PubMed ID = 23132577 ] [ RRC reference ]

Matsunaga Y, Gengyo-Ando K, Mitani S, Iwasaki T, Kawano T.
Physiological function, expression pattern, and transcriptional regulation of a Caenorhabditis elegans insulin-like peptide, INS-18.
Biochem Biophys Res Commun 2012 423(3) 478-83
[ PubMed ID = 22683638 ] [ RRC reference ]

Lee SJ, Murphy CT, Kenyon C.
Glucose shortens the life span of C. elegans by downregulating DAF-16/FOXO activity and aquaporin gene expression.
Cell Metab 2009 10(5) 379-91
[ PubMed ID = 19883616 ] [ RRC reference ]

Ouellet J, Li S, Roy R.
Notch signalling is required for both dauer maintenance and recovery in C. elegans.
Development 2008 135(15) 2583-92
[ PubMed ID = 18599512 ] [ RRC reference ]