分離済み変異体

tm3360

Allele Nametm3360
BalanceNot Required
OutCrossNot Accepted
Sequence NameC55A6.2
Gene Namettll-5
Worm BaseAllele Name tm3360
Gene Name ttll-5
Sequence C55A6.2
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. K. O'Connell: normal cell division and non-Emb.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 12140/12141-TATATATATA-12973/12974 (833 bp deletion + 10 bp insertion)
ChromosomeV
Putative gene structurejoin(11969..12006, 12538..12967, 13016..13183, 13230..13581, 13635..14278, 14326..14678, 14725..14773)
Map position3.17
Balancer
Map position of balancer
Sequence of primersIntRev:GCATGGACGAAGAGGAGGAC,ExtRev:GATCTTCGATGTGCATGGAC,IntFwd:TGTATATCCCTGAATGCCAG,ExtFwd:TGACGAGACGGAGAGATGGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Lu YM, Yan S, Ti SC, Zheng C.
Editing of endogenous tubulins reveals varying effects of tubulin posttranslational modifications on axonal growth and regeneration.
Elife 2024 13  
[ PubMed ID = 38949652 ] [ RRC reference ]

Tran MV, Khuntsariya D, Fetter RD, Ferguson JW, Wang JT, Long AF, Cote LE, Wellard SR, Vázquez-Martínez N, Sallee MD, Genova M, Magiera MM, Eskinazi S, Lee JD, Peel N, Janke C, Stearns T, Shen K, Lansky Z, Magescas J, Feldman JL.
MAP9/MAPH-9 supports axonemal microtubule doublets and modulates motor movement.
Dev Cell 2024 59(2) 199-210.e11 
[ PubMed ID = 38159567 ] [ RRC reference ]

Puri D, Sharma S, Samaddar S, Ravivarma S, Banerjee S, Ghosh-Roy A.
Muscleblind-1 interacts with tubulin mRNAs to regulate the microtubule cytoskeleton in C. elegans mechanosensory neurons.
PLoS Genet 2023 19(8) e1010885 
[ PubMed ID = 37603562 ] [ RRC reference ]

Power KM, Akella JS, Gu A, Walsh JD, Bellotti S, Morash M, Zhang W, Ramadan YH, Ross N, Golden A, Smith HE, Barr MM, O'Hagan R.
Mutation of NEKL-4/NEK10 and TTLL genes suppress neuronal ciliary degeneration caused by loss of CCPP-1 deglutamylase function.
PLoS Genet 2020 16(10) e1009052 
[ PubMed ID = 33064774 ] [ RRC reference ]

O'Hagan R, Silva M, Nguyen KCQ, Zhang W, Bellotti S, Ramadan YH, Hall DH, Barr MM.
Glutamylation Regulates Transport, Specializes Function, and Sculpts the Structure of Cilia.
Curr Biol 2017 27(22) 3430-3441.e6 
[ PubMed ID = 29129530 ] [ RRC reference ]

Chuang M, Hsiao TI, Tong A, Xu S, Chisholm AD.
DAPK interacts with Patronin and the microtubule cytoskeleton in epidermal development and wound repair.
Elife 2016 5  
[ PubMed ID = 27661253 ] [ RRC reference ]

Chawla DG, Shah RV, Barth ZK, Lee JD, Badecker KE, Naik A, Brewster MM, Salmon TP, Peel N.
Caenorhabditis elegans glutamylating enzymes function redundantly in male mating.
Biol Open 2016 5(9) 1290-8 
[ PubMed ID = 27635036 ] [ RRC reference ]

Kimura Y, Kurabe N, Ikegami K, Tsutsumi K, Konishi Y, Kaplan OI, Kunitomo H, Iino Y, Blacque OE, Setou M.
Identification of tubulin deglutamylase among Caenorhabditis elegans and mammalian cytosolic carboxypeptidases (CCPs).
J Biol Chem 2010 285(30) 22936-41 
[ PubMed ID = 20519502 ] [ RRC reference ]