| Allele Name | tm334 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | B0244.2 |
| Gene Name | ida-1 |
| Worm Base | Allele Name |
tm334
|
| Gene Name |
ida-1
|
| Sequence |
B0244.2
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable. Dr. M. Krause: J. Neurosci.24, 3115-3124 (2004). Dr. C. Bargmann & Dr. K. Shen: HSN presynaptic vesicle localization normal. |
|
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 35553/35554-TCGA-36087/36088 (534 bp deletion plus short insertion) |
| Chromosome | III |
| Putative gene structure | join(34661..34721, 34932..35091, 35271..35554,35950..36054, 36551..36568, 36654..36724, 36804..37112, 37495..37630, 37771..37861, 37907..38144, 38233..38512, 39020..39111) |
| Map position | -1.44 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | IntRev:GCTCTTAGCACTCGTTGGTG,ExtRev:CTTTACGACGGAACTCCAAA,ExtFwd:TTGATGGCTGTGCCACCGGT,IntFwd:GCATCAAAAGCATCCACAGT |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Huang H, Zhu Y, Eliot MN, Knopik VS, McGeary JE, Carskadon MA, Hart AC.
Combining Human Epigenetics and Sleep Studies in Caenorhabditis elegans: A Cross-Species Approach for Finding Conserved Genes Regulating Sleep.
Sleep 2017 40(6)
[ PubMed ID = 28431118 ]
[ RRC reference ]
|
Cai T, Fukushige T, Notkins AL, Krause M.
Insulinoma-Associated Protein IA-2, a Vesicle Transmembrane Protein, Genetically Interacts with UNC-31/CAPS and Affects Neurosecretion in Caenorhabditis elegans.
J Neurosci 2004 24(12) 3115-24
[ PubMed ID = 15044551 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.