| Allele Name | tm3334 |
| Allele Type | 通常株 |
| Sequence Name | F09E10.8 |
| Gene Name | toca-1 |
| Worm Base | Allele Name |
tm3334
|
| Gene Name |
toca-1
|
| Sequence |
F09E10.8
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| homozygous viable. Dr. K. Oegema: wt dyf. |
|
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 27325/27326-28479/28480 (1154 bp deletion) |
| Chromosome | X |
| Putative gene structure | complement(join(24644..24713, 24843..25000, 25737..26353, 27287..27597, 28200..28484, 29314..29429, 34938..34970)) |
| Map position | -17.93 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtFwd:AGTGGGATCCTTCCCCTGTG,IntFwd:TGTGCCGGGATTCCCTGATC,ExtRev:ACAGGAATGTACCTACCTAG,IntRev:GTACCTACCTAGGAATCCTG |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Yang Q, Roiz D, Mereu L, Daube M, Hajnal A.
The Invading Anchor Cell Induces Lateral Membrane Constriction during Vulval Lumen Morphogenesis in C. elegans.
Dev Cell 2017 42(3) 271-285.e3
[ PubMed ID = 28787593 ]
[ RRC reference ]
|
Alan JK, Struckhoff EC, Lundquist EA.
Multiple cytoskeletal pathways and PI3K signaling mediate CDC-42-induced neuronal protrusion in C. elegans.
Small GTPases 2013 4(4) 208-20
[ PubMed ID = 24149939 ]
[ RRC reference ]
|
Giuliani C, Troglio F, Bai Z, Patel FB, Zucconi A, Malabarba MG, Disanza A, Stradal TB, Cassata G, Confalonieri S, Hardin JD, Soto MC, Grant BD, Scita G.
Requirements for F-BAR proteins TOCA-1 and TOCA-2 in actin dynamics and membrane trafficking during Caenorhabditis elegans oocyte growth and embryonic epidermal morphogenesis.
PLoS Genet 2009 5(10) e1000675
[ PubMed ID = 19798448 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.