分離済み変異体

tm3310

Allele Nametm3310
Allele Type通常株
Sequence NameZK1128.6
Gene Namettll-4
Worm BaseAllele Name tm3310
Gene Name ttll-4
Sequence ZK1128.6
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. K. O'Connell: normal cell division and non-Emb.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 18995/18996-AAGTTG-19407/19408 (412 bp deletion + 6 bp insertion)
ChromosomeIII
Putative gene structurejoin(13246..13348, 16857..17140, 17527..17628, 18373..18648, 18703..18785, 18858..18986, 19045..19101, 19804..20181, 20849..21097, 21143..21287)
Map position1.87
Balancer
Map position of balancer
Sequence of primersIntRev:CACAGGGGTGGTAAACGATT,ExtRev:GTTTCACCACAGGGGTGGTA,IntFwd:GTAGGACTACTGTAGGCGCA,ExtFwd:TACCCGTAGATTACTCTCAC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Turan MG, Kantarci H, Cevik S, Kaplan OI.
ARL13B regulates juxtaposed cilia-cilia elongation in BBSome dependent manner in Caenorhabditis elegans.
iScience 2025 28(2) 111791 
[ PubMed ID = 39925426 ] [ RRC reference ]

Lu YM, Yan S, Ti SC, Zheng C.
Editing of endogenous tubulins reveals varying effects of tubulin posttranslational modifications on axonal growth and regeneration.
Elife 2024 13  
[ PubMed ID = 38949652 ] [ RRC reference ]

Tran MV, Khuntsariya D, Fetter RD, Ferguson JW, Wang JT, Long AF, Cote LE, Wellard SR, Vázquez-Martínez N, Sallee MD, Genova M, Magiera MM, Eskinazi S, Lee JD, Peel N, Janke C, Stearns T, Shen K, Lansky Z, Magescas J, Feldman JL.
MAP9/MAPH-9 supports axonemal microtubule doublets and modulates motor movement.
Dev Cell 2024 59(2) 199-210.e11 
[ PubMed ID = 38159567 ] [ RRC reference ]

Power KM, Akella JS, Gu A, Walsh JD, Bellotti S, Morash M, Zhang W, Ramadan YH, Ross N, Golden A, Smith HE, Barr MM, O'Hagan R.
Mutation of NEKL-4/NEK10 and TTLL genes suppress neuronal ciliary degeneration caused by loss of CCPP-1 deglutamylase function.
PLoS Genet 2020 16(10) e1009052 
[ PubMed ID = 33064774 ] [ RRC reference ]

Maurya AK, Rogers T, Sengupta P.
A CCRK and a MAK Kinase Modulate Cilia Branching and Length via Regulation of Axonemal Microtubule Dynamics in Caenorhabditis elegans.
Curr Biol 2019 29(8) 1286-1300.e4 
[ PubMed ID = 30955935 ] [ RRC reference ]

Kimura Y, Tsutsumi K, Konno A, Ikegami K, Hameed S, Kaneko T, Kaplan OI, Teramoto T, Fujiwara M, Ishihara T, Blacque OE, Setou M.
Environmental responsiveness of tubulin glutamylation in sensory cilia is regulated by the p38 MAPK pathway.
Sci Rep 2018 8(1) 8392 
[ PubMed ID = 29849065 ] [ RRC reference ]

van der Vaart A, Rademakers S, Jansen G.
DLK-1/p38 MAP Kinase Signaling Controls Cilium Length by Regulating RAB-5 Mediated Endocytosis in Caenorhabditis elegans.
PLoS Genet 2015 11(12) e1005733 
[ PubMed ID = 26657059 ] [ RRC reference ]

Chawla DG, Shah RV, Barth ZK, Lee JD, Badecker KE, Naik A, Brewster MM, Salmon TP, Peel N.
Caenorhabditis elegans glutamylating enzymes function redundantly in male mating.
Biol Open 2016 5(9) 1290-8 
[ PubMed ID = 27635036 ] [ RRC reference ]

O'Hagan R, Silva M, Nguyen KCQ, Zhang W, Bellotti S, Ramadan YH, Hall DH, Barr MM.
Glutamylation Regulates Transport, Specializes Function, and Sculpts the Structure of Cilia.
Curr Biol 2017 27(22) 3430-3441.e6 
[ PubMed ID = 29129530 ] [ RRC reference ]

O'Hagan R, Piasecki BP, Silva M, Phirke P, Nguyen KC, Hall DH, Swoboda P, Barr MM.
The tubulin deglutamylase CCPP-1 regulates the function and stability of sensory cilia in C. elegans.
Curr Biol 2011 21(20) 1685-94 
[ PubMed ID = 21982591 ] [ RRC reference ]

Kimura Y, Kurabe N, Ikegami K, Tsutsumi K, Konishi Y, Kaplan OI, Kunitomo H, Iino Y, Blacque OE, Setou M.
Identification of tubulin deglutamylase among Caenorhabditis elegans and mammalian cytosolic carboxypeptidases (CCPs).
J Biol Chem 2010 285(30) 22936-41 
[ PubMed ID = 20519502 ] [ RRC reference ]