分離済み変異体

tm3287

Allele Nametm3287
BalanceNot Required
OutCrossNot Accepted
Sequence NameK06A1.1
Gene Nameaptf-1
Worm BaseAllele Name tm3287
Gene Name aptf-1
Sequence K06A1.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 14256/14257-14723/14724 (467 bp deletion)
ChromosomeII
Putative gene structurejoin(13643..14066, 14112..14328, 14377..14495, 14671..14939, 14993..15109)
Map position-0.22
Balancer
Map position of balancer
Sequence of primersIntFwd:CCCTATGTCCACCTCCTCCT,ExtFwd:TCATTTTCCCGCCCTATGTC,IntRev:GCACTCATTGCCACGTTTCC,ExtRev:AGTACTGCACTCATTGCCAC
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Pradhan S, Madan GK, Kang D, Bueno E, Atanas AA, Kramer TS, Dag U, Lage JD, Gomes MA, Lu AK, Park J, Flavell SW.
Pathogen infection induces sickness behaviors through neuromodulators linked to stress and satiety in C. elegans.
Nat Commun 2025 16(1) 3200 
[ PubMed ID = 40180949 ] [ RRC reference ]

Moses D, Needham CA, DeBardeleben H.
Quiescent behavior in response to bacterial infection in C. elegans.
MicroPubl Biol 2025 2025  
[ PubMed ID = 40114851 ] [ RRC reference ]

Hill AJ, Robinson B, Jones JG, Sternberg PW, Van Buskirk C.
Sleep drive is coupled to tissue damage via shedding of Caenorhabditis elegans EGFR ligand SISS-1.
Nat Commun 2024 15(1) 10886 
[ PubMed ID = 39738055 ] [ RRC reference ]

Iannacone MJ, Um P, Grubbs JI, van der Linden AM, Raizen DM.
Quiescence Enhances Survival during Viral Infection in Caenorhabditis elegans.
J Neurosci 2024 44(35)  
[ PubMed ID = 39060176 ] [ RRC reference ]

Kramer TS, Wan FK, Pugliese SM, Atanas AA, Hiser AW, Luo J, Bueno E, Flavell SW.
Neural Sequences Underlying Directed Turning in C. elegans.
bioRxiv 2024   
[ PubMed ID = 39149398 ] [ RRC reference ]

Cowen MH, Raizen DM, Hart MP.
Structural neuroplasticity after sleep loss modifies behavior and requires neurexin and neuroligin.
iScience 2024 27(4) 109477 
[ PubMed ID = 38551003 ] [ RRC reference ]

Ardiel EL, Lauziere A, Xu S, Harvey BJ, Christensen RP, Nurrish S, Kaplan JM, Shroff H.
Stereotyped behavioral maturation and rhythmic quiescence in C. elegans embryos.
Elife 2022 11  
[ PubMed ID = 35929725 ] [ RRC reference ]

Chávez-Pérez C, Jafari N, Keenan BT, Raizen DM, Rohacek AM.
Motivated displacement assay distinguishes ALA neuron mutants from RIS neuron mutants during recovery from heat stress in Caenorhabditis elegans.
MicroPubl Biol 2021 2021  
[ PubMed ID = 34557657 ] [ RRC reference ]

McClanahan PD, Dubuque JM, Kontogiorgos-Heintz D, Habermeyer BF, Xu JH, Ma AM, Raizen DM, Fang-Yen C.
A quiescent state following mild sensory arousal in Caenorhabditis elegans is potentiated by stress.
Sci Rep 2020 10(1) 4140 
[ PubMed ID = 32139752 ] [ RRC reference ]

Schuch KN, Govindarajan LN, Guo Y, Baskoylu SN, Kim S, Kimia B, Serre T, Hart AC.
Discriminating between sleep and exercise-induced fatigue using computer vision and behavioral genetics.
J Neurogenet 2020 34(3-4) 453-465 
[ PubMed ID = 32811254 ] [ RRC reference ]

Turek M, Lewandrowski I, Bringmann H.
An AP2 transcription factor is required for a sleep-active neuron to induce sleep-like quiescence in C. elegans.
Curr Biol 2013 23(22) 2215-2223 
[ PubMed ID = 24184105 ] [ RRC reference ]