分離済み変異体

tm3268

Allele Name

tm3268

Balance

Not Required

OutCross

Not Accepted

Sequence Name

F58G6.4

Gene Name

acc-1

Worm Base

Allele Name

tm3268

Gene Name

acc-1

Sequence

F58G6.4

Phenotype

homozygous viable. Dr. H. Sawa: not Psa. Dr. C. Bargmann: reduced locomotion on food.

Mutation site

22068/22069-TCGA-22309/22310 (241 bp deletion + 4 bp insertion)

Chromosome

Putative gene structure

join(21216..21356, 21403..21496, 21644..21809, 21970..22101, 22250..22373, 22457..22536, 22588..22647, 22789..22996, 23190..23276, 23325..23390, 23659..23789, 23944..23985, 24036..24105)

Map position

4.35

Balancer

Map position of balancer

Sequence of primers

IntRev:CAACTCACTTTAGGCGGTAG,IntFwd:CCGGGTTGGATTATGGTGTC,ExtRev:GTGCGGACTAGTTTGCATAC,ExtFwd:TTAGATGAGTCATCCGGGTT

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Zhang Y, Shi Y, Zeng K, Chen L, Gao S.
Hierarchical competing inhibition circuits govern motor stability in C. elegans.
Nat Commun 2025 16(1) 4405
[ PubMed ID = 40355468 ] [ RRC reference ]

Zou W, Fan Y, Liu J, Cheng H, Hong H, Al-Sheikh U, Li S, Zhu L, Li R, He L, Tang YQ, Zhao G, Zhang Y, Wang F, Zhan R, Zheng X, Kang L.
Anoctamin-1 is a core component of a mechanosensory anion channel complex in C. elegans.
Nat Commun 2025 16(1) 1680
[ PubMed ID = 39956854 ] [ RRC reference ]

Huo J, Xu T, Liu Q, Polat M, Kumar S, Zhang X, Leifer AM, Wen Q.
Hierarchical behavior control by a single class of interneurons.
Proc Natl Acad Sci U S A 2024 121(47) e2410789121
[ PubMed ID = 39531495 ] [ RRC reference ]

Kumar S, Sharma AK, Leifer AM.
An inhibitory acetylcholine receptor gates context-dependent mechanosensory processing in C. elegans.
iScience 2024 27(10) 110776
[ PubMed ID = 39381742 ] [ RRC reference ]

Kumar S, Sharma AK, Leifer AM.
An inhibitory acetylcholine receptor gates context dependent mechanosensory processing in C. elegans.
bioRxiv 2024
[ PubMed ID = 38585821 ] [ RRC reference ]

Zhan X, Chen C, Niu L, Du X, Lei Y, Dan R, Wang ZW, Liu P.
Locomotion modulates olfactory learning through proprioception in C. elegans.
Nat Commun 2023 14(1) 4534
[ PubMed ID = 37500635 ] [ RRC reference ]

Hori S, Mitani S.
The transcription factor unc-130/FOXD3/4 contributes to the biphasic calcium response required to optimize avoidance behavior.
Sci Rep 2022 12(1) 1907
[ PubMed ID = 35115609 ] [ RRC reference ]

Takayanagi-Kiya S, Zhou K, Jin Y.
Release-dependent feedback inhibition by a presynaptically localized ligand-gated anion channel.
Elife 2016 5
[ PubMed ID = 27782882 ] [ RRC reference ]

Li Z, Liu J, Zheng M, Xu XZ.
Encoding of both analog- and digital-like behavioral outputs by one C. elegans interneuron.
Cell 2014 159(4) 751-65
[ PubMed ID = 25417153 ] [ RRC reference ]