分離済み変異体

tm3268

Allele Nametm3268
BalanceNot Required
OutCrossNot Accepted
Sequence NameF58G6.4
Gene Nameacc-1
Worm BaseAllele Name tm3268
Gene Name acc-1
Sequence F58G6.4
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. H. Sawa: not Psa. Dr. C. Bargmann: reduced locomotion on food.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 22068/22069-TCGA-22309/22310 (241 bp deletion + 4 bp insertion)
ChromosomeIV
Putative gene structurejoin(21216..21356, 21403..21496, 21644..21809, 21970..22101, 22250..22373, 22457..22536, 22588..22647, 22789..22996, 23190..23276, 23325..23390, 23659..23789, 23944..23985, 24036..24105)
Map position4.35
Balancer
Map position of balancer
Sequence of primersIntRev:CAACTCACTTTAGGCGGTAG,IntFwd:CCGGGTTGGATTATGGTGTC,ExtRev:GTGCGGACTAGTTTGCATAC,ExtFwd:TTAGATGAGTCATCCGGGTT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Zou W, Fan Y, Liu J, Cheng H, Hong H, Al-Sheikh U, Li S, Zhu L, Li R, He L, Tang YQ, Zhao G, Zhang Y, Wang F, Zhan R, Zheng X, Kang L.
Anoctamin-1 is a core component of a mechanosensory anion channel complex in C. elegans.
Nat Commun 2025 16(1) 1680 
[ PubMed ID = 39956854 ] [ RRC reference ]

Huo J, Xu T, Liu Q, Polat M, Kumar S, Zhang X, Leifer AM, Wen Q.
Hierarchical behavior control by a single class of interneurons.
Proc Natl Acad Sci U S A 2024 121(47) e2410789121 
[ PubMed ID = 39531495 ] [ RRC reference ]

Kumar S, Sharma AK, Leifer AM.
An inhibitory acetylcholine receptor gates context-dependent mechanosensory processing in C. elegans.
iScience 2024 27(10) 110776 
[ PubMed ID = 39381742 ] [ RRC reference ]

Kumar S, Sharma AK, Leifer AM.
An inhibitory acetylcholine receptor gates context dependent mechanosensory processing in C. elegans.
bioRxiv 2024   
[ PubMed ID = 38585821 ] [ RRC reference ]

Zhan X, Chen C, Niu L, Du X, Lei Y, Dan R, Wang ZW, Liu P.
Locomotion modulates olfactory learning through proprioception in C. elegans.
Nat Commun 2023 14(1) 4534 
[ PubMed ID = 37500635 ] [ RRC reference ]

Hori S, Mitani S.
The transcription factor unc-130/FOXD3/4 contributes to the biphasic calcium response required to optimize avoidance behavior.
Sci Rep 2022 12(1) 1907 
[ PubMed ID = 35115609 ] [ RRC reference ]

Takayanagi-Kiya S, Zhou K, Jin Y.
Release-dependent feedback inhibition by a presynaptically localized ligand-gated anion channel.
Elife 2016 5  
[ PubMed ID = 27782882 ] [ RRC reference ]

Li Z, Liu J, Zheng M, Xu XZ.
Encoding of both analog- and digital-like behavioral outputs by one C. elegans interneuron.
Cell 2014 159(4) 751-65 
[ PubMed ID = 25417153 ] [ RRC reference ]