Home > 分離済み変異体 > tm3262

分離済み変異体

Allele Name		tm3262
Balance		Not Required
OutCross		Not Accepted
Sequence Name		C43G2.1
Gene Name		C43G2.1
Worm Base	Allele Name	tm3262
	Gene Name	C43G2.1
	Sequence	C43G2.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		2028/2029-TT-2566/2567 (538 bp deletion + 2 bp insertion)
Chromosome		IV
Putative gene structure		complement(join(1044..1157, 1205..1371, 1431..1752, 2386..2557, 2605..2814, 2871..3097, 3482..3574))
Map position		3.21
Balancer
Map position of balancer
Sequence of primers		IntFwd:ATAGAACGGCACCAGCGAAG,ExtFwd:AACGAGAGTCCAAGACATAG,ExtRev:GCGTGATTGTCGTCGGGAAT,IntRev:CGTCGGGAATAGAACGATCA
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Horikawa M, Fukuyama M, Antebi A, Mizunuma M. Regulatory mechanism of cold-inducible diapause in Caenorhabditis elegans. Nat Commun 2024 15(1) 5793  [ PubMed ID = 38987256 ] [ RRC reference ] Chen YL, Ma YC, Tang J, Zhang D, Zhao Q, Liu JJ, Tang HS, Zhang JY, He GH, Zhong CH, Wu YT, Wen HR, Ma LQ, Zou CG. Physical exercise attenuates age-related muscle atrophy and exhibits anti-ageing effects via the adiponectin receptor 1 signalling. J Cachexia Sarcopenia Muscle 2023 14(4) 1789-1801  [ PubMed ID = 37222007 ] [ RRC reference ] Eck RJ, Stair JG, Kraemer BC, Liachko NF. Simple models to understand complex disease: 10 years of progress from Caenorhabditis elegans models of amyotrophic lateral sclerosis and frontotemporal lobar degeneration. Front Neurosci 2023 17 1300705  [ PubMed ID = 38239833 ] [ RRC reference ] Devkota R, Kaper D, Bodhicharla R, Henricsson M, Borén J, Pilon M. A genetic titration of membrane composition in Caenorhabditis elegans reveals its importance for multiple cellular and physiological traits. Genetics 2021 219(1)   [ PubMed ID = 34125894 ] [ RRC reference ] Busayavalasa K, Ruiz M, Devkota R, Ståhlman M, Bodhicharla R, Svensk E, Hermansson NO, Borén J, Pilon M. Leveraging a gain-of-function allele of Caenorhabditis elegans paqr-1 to elucidate membrane homeostasis by PAQR proteins. PLoS Genet 2020 16(8) e1008975  [ PubMed ID = 32750056 ] [ RRC reference ] Liachko NF, Saxton AD, McMillan PJ, Strovas TJ, Keene CD, Bird TD, Kraemer BC. Genome wide analysis reveals heparan sulfate epimerase modulates TDP-43 proteinopathy. PLoS Genet 2019 15(12) e1008526  [ PubMed ID = 31834878 ] [ RRC reference ] Kyriakakis E, Charmpilas N, Tavernarakis N. Differential adiponectin signalling couples ER stress with lipid metabolism to modulate ageing in C. elegans. Sci Rep 2017 7(1) 5115  [ PubMed ID = 28698593 ] [ RRC reference ] Svensk E, Ståhlman M, Andersson CH, Johansson M, Borén J, Pilon M. PAQR-2 regulates fatty acid desaturation during cold adaptation in C. elegans. PLoS Genet 2013 9(9) e1003801  [ PubMed ID = 24068966 ] [ RRC reference ] Svensson E, Olsen L, Mörck C, Brackmann C, Enejder A, Faergeman NJ, Pilon M. The adiponectin receptor homologs in C. elegans promote energy utilization and homeostasis. PLoS One 2011 6(6) e21343  [ PubMed ID = 21712952 ] [ RRC reference ]