分離済み変異体

tm324

Allele Nametm324
BalanceNot Required
OutCrossNot Accepted
Sequence NameF20C5.2
Gene Nameklp-11
Worm BaseAllele Name tm324
Gene Name klp-11
Sequence F20C5.2
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable; Dr. M.M. Barr: Dyf+, PKD-2::GFP localization: subtle ciliary mislocalization; Dr. P. Sengupta: 10% of animals fail to dye-fill one AWB neuron when grwon at 25C. Other neurons dye-fill normally. Dr. K. Shen: normal synapse formation as determined by RAB-3 and CCB-1 localization to presynaptic sites in HSNL. Dr. C. Bargmann: locomotion OK. Dr. H. Sawa: 0% Psa.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 15970/15971-16332/16333 (362 bp deletion)
ChromosomeIV
Putative gene structurecomplement(join(12579..12756, 12832..13218, 13268..13435, 13540..13599, 13738..13934, 13984..14106, 14390..14524, 14807..14952, 15446..15548, 16119..16234, 16325..16467, 16686..16783,16835..17431, 17474..17795, 17847..17917, 17970..18062, 18106..18355, 18495..18599, 18649..18704, 19251..19295)
Map position3.96
Balancer
Map position of balancer
Sequence of primersExtFwd:CTCCTCTGAGCACCGAATTG,IntFwd:TCTCGAGCTGTTTCCACGAG,ExtRev:TCCAAAAGAGCAAGATGAGC,IntRev:GAGCCATCGAAGGATTTTAC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Sheng Y, Abreu A, Markovich Z, Ebea P, Davis L, Park E, Sheng P, Xie M, Han SM, Xiao R.
A mitochondrial unfolded protein response-independent role of DVE-1 in longevity regulation.
Cell Rep 2024 43(11) 114889 
[ PubMed ID = 39423131 ] [ RRC reference ]

Lei M, Wu J, Tan Y, Shi Y, Yang W, Tu H, Tan W.
β-asarone protects against age-related motor decline via activation of SKN-1/Nrf2 and subsequent induction of GST-4.
Pharmacol Res 2024 209 107450 
[ PubMed ID = 39366648 ] [ RRC reference ]

Xie C, Chen G, Li M, Huang P, Chen Z, Lei K, Li D, Wang Y, Cleetus A, Mohamed MA, Sonar P, Feng W, Ökten Z, Ou G.
Neurons dispose of hyperactive kinesin into glial cells for clearance.
EMBO J 2024 43(13) 2606-2635 
[ PubMed ID = 38806659 ] [ RRC reference ]

Quesnelle DC, Huang C, Boudreau JR, Lam A, Paw J, Bendena WG, Chin-Sang ID.
C. elegans vab-6 encodes a KIF3A kinesin and functions cell non-autonomously to regulate epidermal morphogenesis.
Dev Biol 2023 497 33-41 
[ PubMed ID = 36893881 ] [ RRC reference ]

Clupper M, Gill R, Elsayyid M, Touroutine D, Caplan JL, Tanis JE.
Kinesin-2 motors differentially impact biogenesis of extracellular vesicle subpopulations shed from sensory cilia.
iScience 2022 25(11) 105262 
[ PubMed ID = 36304122 ] [ RRC reference ]

Zhang X, Liu J, Pan T, Ward A, Liu J, Xu XZS.
A cilia-independent function of BBSome mediated by DLK-MAPK signaling in C. elegans photosensation.
Dev Cell 2022 57(12) 1545-1557.e4 
[ PubMed ID = 35649417 ] [ RRC reference ]

Park K, Li C, Tsiropoulou S, Gonçalves J, Kondratev C, Pelletier L, Blacque OE, Leroux MR.
CDKL kinase regulates the length of the ciliary proximal segment.
Curr Biol 2021 31(11) 2359-2373.e7 
[ PubMed ID = 33857430 ] [ RRC reference ]

Xie C, Li L, Li M, Shao W, Zuo Q, Huang X, Chen R, Li W, Brunnbauer M, Ökten Z, Chen L, Ou G.
Optimal sidestepping of intraflagellar transport kinesins regulates structure and function of sensory cilia.
EMBO J 2020 39(12) e103955 
[ PubMed ID = 32338401 ] [ RRC reference ]

Kazatskaya A, Kuhns S, Lambacher NJ, Kennedy JE, Brear AG, McManus GJ, Sengupta P, Blacque OE.
Primary Cilium Formation and Ciliary Protein Trafficking Is Regulated by the Atypical MAP Kinase MAPK15 in Caenorhabditis elegans and Human Cells.
Genetics 2017 207(4) 1423-1440 
[ PubMed ID = 29021280 ] [ RRC reference ]

O'Hagan R, Silva M, Nguyen KCQ, Zhang W, Bellotti S, Ramadan YH, Hall DH, Barr MM.
Glutamylation Regulates Transport, Specializes Function, and Sculpts the Structure of Cilia.
Curr Biol 2017 27(22) 3430-3441.e6 
[ PubMed ID = 29129530 ] [ RRC reference ]

Niwa S.
The nephronophthisis-related gene ift-139 is required for ciliogenesis in Caenorhabditis elegans.
Sci Rep 2016 6 31544 
[ PubMed ID = 27515926 ] [ RRC reference ]

Sanders AA, de Vrieze E, Alazami AM, Alzahrani F, Malarkey EB, Sorusch N, Tebbe L, Kuhns S, van Dam TJ, Alhashem A, Tabarki B, Lu Q, Lambacher NJ, Kennedy JE, Bowie RV, Hetterschijt L, van Beersum S, van Reeuwijk J, Boldt K, Kremer H, Kesterson RA, Monies D, Abouelhoda M, Roepman R, Huynen MH, Ueffing M, Russell RB, Wolfrum U, Yoder BK, van Wijk E, Alkuraya FS, Blacque OE.
KIAA0556 is a novel ciliary basal body component mutated in Joubert syndrome.
Genome Biol 2015 16 293 
[ PubMed ID = 26714646 ] [ RRC reference ]

Wang J, Silva M, Haas LA, Morsci NS, Nguyen KC, Hall DH, Barr MM.
C. elegans ciliated sensory neurons release extracellular vesicles that function in animal communication.
Curr Biol 2014 24(5) 519-25 
[ PubMed ID = 24530063 ] [ RRC reference ]

Barsi-Rhyne BJ, Miller KM, Vargas CT, Thomas AB, Park J, Bremer M, Jarecki JL, VanHoven MK.
Kinesin-1 acts with netrin and DCC to maintain sensory neuron position in Caenorhabditis elegans.
Genetics 2013 194(1) 175-87 
[ PubMed ID = 23475988 ] [ RRC reference ]

Cevik S, Sanders AA, Van Wijk E, Boldt K, Clarke L, van Reeuwijk J, Hori Y, Horn N, Hetterschijt L, Wdowicz A, Mullins A, Kida K, Kaplan OI, van Beersum SE, Man Wu K, Letteboer SJ, Mans DA, Katada T, Kontani K, Ueffing M, Roepman R, Kremer H, Blacque OE.
Active transport and diffusion barriers restrict Joubert Syndrome-associated ARL13B/ARL-13 to an Inv-like ciliary membrane subdomain.
PLoS Genet 2013 9(12) e1003977 
[ PubMed ID = 24339792 ] [ RRC reference ]

Kaplan OI, Doroquez DB, Cevik S, Bowie RV, Clarke L, Sanders AA, Kida K, Rappoport JZ, Sengupta P, Blacque OE.
Endocytosis genes facilitate protein and membrane transport in C. elegans sensory cilia.
Curr Biol 2012 22(6) 451-60 
[ PubMed ID = 22342749 ] [ RRC reference ]

Mok CA, Healey MP, Shekhar T, Leroux MR, Héon E, Zhen M.
Mutations in a guanylate cyclase GCY-35/GCY-36 modify Bardet-Biedl syndrome-associated phenotypes in Caenorhabditis elegans.
PLoS Genet 2011 7(10) e1002335 
[ PubMed ID = 22022287 ] [ RRC reference ]

Hao L, Thein M, Brust-Mascher I, Civelekoglu-Scholey G, Lu Y, Acar S, Prevo B, Shaham S, Scholey JM.
Intraflagellar transport delivers tubulin isotypes to sensory cilium middle and distal segments.
Nat Cell Biol 2011 13(7) 790-8 
[ PubMed ID = 21642982 ] [ RRC reference ]

Hao L, Efimenko E, Swoboda P, Scholey JM.
The retrograde IFT machinery of C. elegans cilia: two IFT dynein complexes?
PLoS One 2011 6(6) e20995 
[ PubMed ID = 21695221 ] [ RRC reference ]

Kaplan OI, Molla-Herman A, Cevik S, Ghossoub R, Kida K, Kimura Y, Jenkins P, Martens JR, Setou M, Benmerah A, Blacque OE.
The AP-1 clathrin adaptor facilitates cilium formation and functions with RAB-8 in C. elegans ciliary membrane transport.
J Cell Sci 2010 123(Pt 22) 3966-77 
[ PubMed ID = 20980383 ] [ RRC reference ]