分離済み変異体

tm3236

Allele Nametm3236
BalanceNot Required
OutCrossNot Accepted
Sequence NameD1009.1a
Gene Nameacs-22
Worm BaseAllele Name tm3236
Gene Name acs-22
Sequence D1009.1a
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. S. Mitani: PLoS One, 5 (1), e8857 (2010).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 36159/36160-36574/36575 (415 bp deletion)
ChromosomeX
Putative gene structurejoin(30386..30390, 33624..33797, 34402..34489, 34620..34727, 35690..35888, 35971..36427, 36472..36635, 37023..37468, 37555..37620, 37675..37771, 37822..37985)
Map position0.45
Balancer
Map position of balancer
Sequence of primersExtFwd:CTTGGGTTCACATCGTACGT,IntFwd:GGTTACAAAATGGGCGACGT,ExtRev:AGCAGTCCTGGAAATACGTC,IntRev:GAGCCGTACAACTCTCCAAT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Ruan M, Xu F, Li N, Yu J, Teng F, Tang J, Huang C, Zhu H.
Free long-chain fatty acids trigger early postembryonic development in starved Caenorhabditis elegans by suppressing mTORC1.
PLoS Biol 2024 22(10) e3002841 
[ PubMed ID = 39436954 ] [ RRC reference ]

Mørch MGM, Møller KV, Hesselager MO, Harders RH, Kidmose CL, Buhl T, Fuursted K, Bendixen E, Shen C, Christensen LG, Poulsen CH, Olsen A.
The TGF-β ligand DBL-1 is a key player in a multifaceted probiotic protection against MRSA in C. elegans.
Sci Rep 2021 11(1) 10717 
[ PubMed ID = 34021197 ] [ RRC reference ]

Li S, Li Q, Kong Y, Wu S, Cui Q, Zhang M, Zhang SO.
Specific regulation of thermosensitive lipid droplet fusion by a nuclear hormone receptor pathway.
Proc Natl Acad Sci U S A 2017 114(33) 8841-8846 
[ PubMed ID = 28760992 ] [ RRC reference ]

Li S, Xu S, Ma Y, Wu S, Feng Y, Cui Q, Chen L, Zhou S, Kong Y, Zhang X, Yu J, Wu M, Zhang SO.
A Genetic Screen for Mutants with Supersized Lipid Droplets in Caenorhabditis elegans.
G3 (Bethesda) 2016 6(8) 2407-19 
[ PubMed ID = 27261001 ] [ RRC reference ]

Imae R, Inoue T, Kimura M, Kanamori T, Tomioka NH, Kage-Nakadai E, Mitani S, Arai H.
Intracellular phospholipase A1 and acyltransferase, which are involved in Caenorhabditis elegans stem cell divisions, determine the sn-1 fatty acyl chain of phosphatidylinositol.
Mol Biol Cell 2010 21(18) 3114-24 
[ PubMed ID = 20668164 ] [ RRC reference ]

Kage-Nakadai E, Kobuna H, Kimura M, Gengyo-Ando K, Inoue T, Arai H, Mitani S.
Two very long chain fatty acid acyl-CoA synthetase genes, acs-20 and acs-22, have roles in the cuticle surface barrier in Caenorhabditis elegans.
PLoS One 2010 5(1) e8857 
[ PubMed ID = 20111596 ] [ RRC reference ]