Home > 分離済み変異体 > tm3232

分離済み変異体

Allele Name		tm3232
Balance		Not Required
OutCross		Not Accepted
Sequence Name		F28D1.9
Gene Name		acs-20
Worm Base	Allele Name	tm3232 (x1)
	Gene Name	acs-20
	Sequence	F28D1.9
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable. Dr. S. Mitani: PLoS One, 5 (1), e8857 (2010).
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		23952/23953-TT-24245/24246 (293 bp deletion + 2 bp insertion)
Chromosome		IV
Putative gene structure		complement(join(22436..22590, 23485..24099, 24291..24407, 24464..24808, 24857..25018, 25069..25267, 25537..25636, 25681..25776, 26557..26720))
Map position		5.91
Balancer		nT1
Map position of balancer
Sequence of primers		ExtFwd:ATCGCGTAGCTGGTAAGCGA,IntFwd:ACTCGAACAACTGACGCCAT,ExtRev:TTGAGGTTTACTCTGTCGGA,IntRev:ACTACGGAACCAAAGACCCT
Distributed lab
Depositor		Dr. S. Mitani
References		Please submit your publication Ruan M, Xu F, Li N, Yu J, Teng F, Tang J, Huang C, Zhu H. Free long-chain fatty acids trigger early postembryonic development in starved Caenorhabditis elegans by suppressing mTORC1. PLoS Biol 2024 22(10) e3002841  [ PubMed ID = 39436954 ] [ RRC reference ] Wang Z, Zou L, Zhang Y, Zhu M, Zhang S, Wu D, Lan J, Zang X, Wang Q, Zhang H, Wu Z, Zhu H, Chen D. ACS-20/FATP4 mediates the anti-ageing effect of dietary restriction in C. elegans. Nat Commun 2023 14(1) 7683  [ PubMed ID = 38001113 ] [ RRC reference ] Atkinson LE, Liu Y, McKay F, Vandewyer E, Viau C, Irvine A, Rosa BA, Li Z, Liang Q, Marks NJ, Maule AG, Mitreva M, Beets I, Li L, Mousley A. Ascaris suum Informs Extrasynaptic Volume Transmission in Nematodes. ACS Chem Neurosci 2021 12(17) 3176-3188  [ PubMed ID = 34347433 ] [ RRC reference ] Jiang Q, Li K, Lu WJ, Li S, Chen X, Liu XJ, Yuan J, Ding Q, Lan F, Cai SQ. Identification of small-molecule ion channel modulators in C. elegans channelopathy models. Nat Commun 2018 9(1) 3941  [ PubMed ID = 30258187 ] [ RRC reference ] Wang H, Jiang X, Wu J, Zhang L, Huang J, Zhang Y, Zou X, Liang B. Iron Overload Coordinately Promotes Ferritin Expression and Fat Accumulation in Caenorhabditis elegans. Genetics 2016 203(1) 241-53  [ PubMed ID = 27017620 ] [ RRC reference ] Imae R, Inoue T, Kimura M, Kanamori T, Tomioka NH, Kage-Nakadai E, Mitani S, Arai H. Intracellular phospholipase A1 and acyltransferase, which are involved in Caenorhabditis elegans stem cell divisions, determine the sn-1 fatty acyl chain of phosphatidylinositol. Mol Biol Cell 2010 21(18) 3114-24  [ PubMed ID = 20668164 ] [ RRC reference ] Kage-Nakadai E, Kobuna H, Kimura M, Gengyo-Ando K, Inoue T, Arai H, Mitani S. Two very long chain fatty acid acyl-CoA synthetase genes, acs-20 and acs-22, have roles in the cuticle surface barrier in Caenorhabditis elegans. PLoS One 2010 5(1) e8857  [ PubMed ID = 20111596 ] [ RRC reference ]