| Allele Name | tm322 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | B0207.11 |
| Gene Name | B0207.11 |
| Worm Base | Allele Name |
tm322
|
| Gene Name |
B0207.11
|
| Sequence |
B0207.11
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable |
|
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 44495/44496-44907/44908 (412 bp deletion) |
| Chromosome | I |
| Putative gene structure | complement(join(43985..44414, 44463..44537, 44585..44838, 45016..45078)) |
| Map position | 0.5 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | IntFwd:TCTTCTATTCAAGCCACCAAGAAA,IntRev:CTGATGTTCACTGGTACCTG,ExtFwd:ATCATTGAATCCACTTGTTTACTC,ExtRev:GTTCTTTGCACAGGTATCTG |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Tuckowski AM, Beydoun S, Kitto ES, Bhat A, Howington MB, Sridhar A, Bhandari M, Chambers K, Leiser SF.
fmo-4 promotes longevity and stress resistance via ER to mitochondria calcium regulation in C. elegans.
Elife 2025 13
[ PubMed ID = 39951337 ]
[ RRC reference ]
|
Murari E, Meadows D, Cuda N, Mangone M.
A comprehensive analysis of 3'UTRs in Caenorhabditis elegans.
Nucleic Acids Res 2024 52(13) 7523-7538
[ PubMed ID = 38917330 ]
[ RRC reference ]
|
Weng Y, Murphy CT.
Male-specific behavioral and transcriptomic changes in aging C. elegans neurons.
iScience 2024 27(6) 109910
[ PubMed ID = 38783998 ]
[ RRC reference ]
|
McGovern M, Yu L, Kosinski M, Greenstein D, Savage-Dunn C.
A role for sperm in regulation of egg-laying in the nematode C. elegans.
BMC Dev Biol 2007 7 41
[ PubMed ID = 17472754 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.