分離済み変異体

tm321

Allele Nametm321
BalanceNot Required
OutCrossNot Accepted
Sequence NameF22D3.1a
Gene Nameceh-38
Worm BaseAllele Name tm321
Gene Name ceh-38
Sequence F22D3.1a
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. D. Portman: male tail normal. Dr. O. Hobert: normal ASE development. Dr. WB Derry: normal germline apoptosis.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 27464/27465-27984/27985 (520 bp deletion)
ChromosomeII
Putative gene structurejoin (27077..27114, 27160..27471, 27520..27622, 27751..28066, 28189..28675, 28796..29036, 29170..29256, 29386..29736)
Map position0.16
Balancer
Map position of balancer
Sequence of primersExtFwd:CTCCCTGTGGCCATCAGTAT,IntFwd:TCGCAACTAGTATGTTCTCCCA,ExtRev:CAGAATGACTAGGACCCGGA,IntRev:ACATTTCCGCCATCTGAAAC
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Leyva-Díaz E, Cesar M, Pe K, Jordá-Llorens JI, Valdivia J, Hobert O.
Alternative splicing controls pan-neuronal homeobox gene expression.
Genes Dev 2025 39(3-4) 209-220 
[ PubMed ID = 39730199 ] [ RRC reference ]

Mazzetto M, Gonzalez LE, Sanchez N, Reinke V.
Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis.
Genome Res 2024 34(1) 57-69 
[ PubMed ID = 38164610 ] [ RRC reference ]

Staal J, Driege Y, Haegman M, Borghi A, Hulpiau P, Lievens L, Gul IS, Sundararaman S, Gonçalves A, Dhondt I, Pinzón JH, Braeckman BP, Technau U, Saeys Y, van Roy F, Beyaert R.
Ancient Origin of the CARD-Coiled Coil/Bcl10/MALT1-Like Paracaspase Signaling Complex Indicates Unknown Critical Functions.
Front Immunol 2018 9 1136 
[ PubMed ID = 29881386 ] [ RRC reference ]

Fuxman Bass JI, Pons C, Kozlowski L, Reece-Hoyes JS, Shrestha S, Holdorf AD, Mori A, Myers CL, Walhout AJ.
A gene-centered C. elegans protein-DNA interaction network provides a framework for functional predictions.
Mol Syst Biol 2016 12(10) 884 
[ PubMed ID = 27777270 ] [ RRC reference ]

Smith CJ, Watson JD, Spencer WC, O'Brien T, Cha B, Albeg A, Treinin M, Miller DM 3rd.
Time-lapse imaging and cell-specific expression profiling reveal dynamic branching and molecular determinants of a multi-dendritic nociceptor in C. elegans.
Dev Biol 2010 345(1) 18-33 
[ PubMed ID = 20537990 ] [ RRC reference ]