分離済み変異体

tm3188

Allele Nametm3188
BalanceNot Required
OutCrossNot Accepted
Sequence NameK08E7.1
Gene Nameeak-7
Worm BaseAllele Name tm3188
Gene Name eak-7
Sequence K08E7.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 4705/4706-5222/5223 (517 bp deletion)
ChromosomeIV
Putative gene structurecomplement(join(3087..3284, 3345..3467, 3549..3694, 4139..4565, 4613..4792, 4848..4973))
Map position6.02
Balancer
Map position of balancer
Sequence of primersIntFwd:TGTGTACCTTGCGAGGCGAA,ExtRev:GCACGTGTTGAGAGGATTCA,IntRev:ACTATGTTGTGCCTCCTGCT,ExtFwd:TAACACAGCCATGTGTGGAT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Delaney CE, Chen AT, Graniel JV, Dumas KJ, Hu PJ.
A histone H4 lysine 20 methyltransferase couples environmental cues to sensory neuron control of developmental plasticity.
Development 2017 144(7) 1273-1282 
[ PubMed ID = 28209779 ] [ RRC reference ]

Itani OA, Flibotte S, Dumas KJ, Guo C, Blumenthal T, Hu PJ.
N-Ethyl-N-Nitrosourea (ENU) Mutagenesis Reveals an Intronic Residue Critical for Caenorhabditis elegans 3' Splice Site Function in Vivo.
G3 (Bethesda) 2016 6(6) 1751-6 
[ PubMed ID = 27172199 ] [ RRC reference ]

Itani OA, Flibotte S, Dumas KJ, Moerman DG, Hu PJ.
Chromoanasynthetic Genomic Rearrangement Identified in a N-Ethyl-N-Nitrosourea (ENU) Mutagenesis Screen in Caenorhabditis elegans.
G3 (Bethesda) 2015 6(2) 351-6 
[ PubMed ID = 26628482 ] [ RRC reference ]

Dumas KJ, Delaney CE, Flibotte S, Moerman DG, Csankovszki G, Hu PJ.
Unexpected role for dosage compensation in the control of dauer arrest, insulin-like signaling, and FoxO transcription factor activity in Caenorhabditis elegans.
Genetics 2013 194(3) 619-29 
[ PubMed ID = 23733789 ] [ RRC reference ]

Ferguson AA, Roy S, Kormanik KN, Kim Y, Dumas KJ, Ritov VB, Matern D, Hu PJ, Fisher AL.
TATN-1 mutations reveal a novel role for tyrosine as a metabolic signal that influences developmental decisions and longevity in Caenorhabditis elegans.
PLoS Genet 2013 9(12) e1004020 
[ PubMed ID = 24385923 ] [ RRC reference ]

Alam H, Williams TW, Dumas KJ, Guo C, Yoshina S, Mitani S, Hu PJ.
EAK-7 controls development and life span by regulating nuclear DAF-16/FoxO activity.
Cell Metab 2010 12(1) 30-41 
[ PubMed ID = 20620993 ] [ RRC reference ]