分離済み変異体

tm3163

Allele Nametm3163
BalanceNot Required
OutCrossNot Accepted
Sequence NameY55F3AM.12
Gene Namedcap-1
Worm BaseAllele Name tm3163
Gene Name dcap-1
Sequence Y55F3AM.12
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. H. Zhang: normal locomotion, Gro and small brood size at 25 C.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 74149/74150-74483/74484 (334 bp deletion)
ChromosomeIV
Putative gene structurecomplement(join(73580..73684, 74389..75073, 75140..75249, 75299..75397))
Map position-22.41
Balancer
Map position of balancer
Sequence of primersIntRev:AGCTAGCCGCGAAAAACCTC,ExtRev:ACCAGTATGAGCGACGCTAA,IntFwd:TACCTAAGCTAGACTAAGCC,ExtFwd:TAGGTGGGCGATTGCTGAGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Baiocchi T, Anesko K, Mercado N, Park H, Kin K, Strickhouser-Monzon B, Robles P, Bowman C, Wang H, Sternberg PW, Dillman AR.
Signaling by AWC Olfactory Neurons Is Necessary for Caenorhabditis elegans' Response to Prenol, an Odor Associated with Nematode-Infected Insects.
Genetics 2020 216(1) 145-157 
[ PubMed ID = 32680884 ] [ RRC reference ]

Borbolis F, Rallis J, Kanatouris G, Kokla N, Karamalegkos A, Vasileiou C, Vakaloglou KM, Diallinas G, Stravopodis DJ, Zervas CG, Syntichaki P.
mRNA decapping is an evolutionarily conserved modulator of neuroendocrine signaling that controls development and ageing.
Elife 2020 9  
[ PubMed ID = 32366357 ] [ RRC reference ]

Adachi T, Nagahama K, Izumi S.
The C. elegans mRNA decapping enzyme shapes morphology of cilia.
Biochem Biophys Res Commun 2017 493(1) 382-387 
[ PubMed ID = 28887031 ] [ RRC reference ]

Borbolis F, Flessa CM, Roumelioti F, Diallinas G, Stravopodis DJ, Syntichaki P.
Neuronal function of the mRNA decapping complex determines survival of Caenorhabditis elegans at high temperature through temporal regulation of heterochronic gene expression.
Open Biol 2017 7(3)  
[ PubMed ID = 28250105 ] [ RRC reference ]

Rousakis A, Vlanti A, Borbolis F, Roumelioti F, Kapetanou M, Syntichaki P.
Diverse functions of mRNA metabolism factors in stress defense and aging of Caenorhabditis elegans.
PLoS One 2014 9(7) e103365 
[ PubMed ID = 25061667 ] [ RRC reference ]

Sun Y, Yang P, Zhang Y, Bao X, Li J, Hou W, Yao X, Han J, Zhang H.
A genome-wide RNAi screen identifies genes regulating the formation of P bodies in C. elegans and their functions in NMD and RNAi.
Protein Cell 2011 2(11) 918-39 
[ PubMed ID = 22180091 ] [ RRC reference ]