| Allele Name | tm3153 |
| Balance | Completed |
| OutCross | Not Accepted |
| Sequence Name | T26A5.9 |
| Gene Name | dlc-1 |
| Worm Base | Allele Name |
tm3153
(x1) |
| Gene Name |
dlc-1
|
| Sequence |
T26A5.9
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| lethal or sterile. Dr. Y-C. Wu: Emb, abnormal cell devision. Dr. K. O'Conell: mostly Ste. Dr. E.T. Kipreos: Ste, Prv. |
|
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 15520/15521-15693/15694 (173 bp deletion) |
| Chromosome | III |
| Putative gene structure | complement(join(15372..15549, 15830..15921)) |
| Map position | -1.25 |
| Balancer | hT2,hT2 [bli-4(e937) let-? qIs48] |
| Map position of balancer | |
| Sequence of primers | IntRev:CCTCCGCATTCCGCATTCAC,IntFwd:AGGATGGGATTTATCCAGAC,ExtRev:TACTCAAGTGCCTCCGAGCT,ExtFwd:GTACACGTAGGATCAGGTCA |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Fielder SM, Kent T, Ling H, Gleason EJ, Kelly WG.
A motor independent requirement for dynein light chain in Caenorhabditis elegans meiotic synapsis.
Genetics 2022 220(1)
[ PubMed ID = 34788833 ]
[ RRC reference ]
|
Ellenbecker M, Osterli E, Wang X, Day NJ, Baumgarten E, Hickey B, Voronina E.
Dynein Light Chain DLC-1 Facilitates the Function of the Germline Cell Fate Regulator GLD-1 in Caenorhabditis elegans.
Genetics 2019 211(2) 665-681
[ PubMed ID = 30509955 ]
[ RRC reference ]
|
Day NJ, Ellenbecker M, Voronina E.
Caenorhabditis elegans DLC-1 associates with ribonucleoprotein complexes to promote mRNA regulation.
FEBS Lett 2018 592(22) 3683-3695
[ PubMed ID = 30264890 ]
[ RRC reference ]
|
Wang X, Olson JR, Rasoloson D, Ellenbecker M, Bailey J, Voronina E.
Dynein light chain DLC-1 promotes localization and function of the PUF protein FBF-2 in germline progenitor cells.
Development 2016 143(24) 4643-4653
[ PubMed ID = 27864381 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.